Transcript: Human XM_017001602.1

PREDICTED: Homo sapiens leucine rich repeat containing 8 VRAC subunit D (LRRC8D), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC8D (55144)
Length:
3399
CDS:
467..3043

Additional Resources:

NCBI RefSeq record:
XM_017001602.1
NBCI Gene record:
LRRC8D (55144)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281985 GGCGGACAACAAACGACATTT pLKO_005 741 CDS 100% 13.200 18.480 N LRRC8D n/a
2 TRCN0000148769 CCAGCTATATTCCAAGCGTTT pLKO.1 1747 CDS 100% 4.050 5.670 N LRRC8D n/a
3 TRCN0000276208 CCAGCTATATTCCAAGCGTTT pLKO_005 1747 CDS 100% 4.050 5.670 N LRRC8D n/a
4 TRCN0000276255 AGATAGTGACTTGATCTATAA pLKO_005 1363 CDS 100% 13.200 9.240 N LRRC8D n/a
5 TRCN0000147543 GAAGGCTGATAGAAGACATAA pLKO.1 3176 3UTR 100% 13.200 9.240 N LRRC8D n/a
6 TRCN0000147226 GAAGTCAAAGAGGCATTGAAT pLKO.1 2987 CDS 100% 5.625 3.938 N LRRC8D n/a
7 TRCN0000276209 GAAGTCAAAGAGGCATTGAAT pLKO_005 2987 CDS 100% 5.625 3.938 N LRRC8D n/a
8 TRCN0000149858 GCAGGAACAACTTCCTAGATT pLKO.1 3071 3UTR 100% 0.563 0.394 N LRRC8D n/a
9 TRCN0000148459 CGAAGTCAAAGAGGCATTGAA pLKO.1 2986 CDS 100% 5.625 3.375 N LRRC8D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15887 pDONR223 0% 16.5% 16% None (many diffs) n/a
2 ccsbBroad304_15887 pLX_304 0% 16.5% 16% V5 (many diffs) n/a
3 TRCN0000473967 CGATAAACCCCATATGAGTACGCC pLX_317 100% 16.5% 16% V5 (many diffs) n/a
Download CSV