Transcript: Human XM_017001864.1

PREDICTED: Homo sapiens SCY1 like pseudokinase 3 (SCYL3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCYL3 (57147)
Length:
2862
CDS:
598..2238

Additional Resources:

NCBI RefSeq record:
XM_017001864.1
NBCI Gene record:
SCYL3 (57147)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001864.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412332 AGCGCTCTGCACCTTACTATC pLKO_005 873 CDS 100% 10.800 15.120 N SCYL3 n/a
2 TRCN0000002388 CACTGAGAGAACCACCATTTA pLKO.1 180 5UTR 100% 13.200 10.560 N SCYL3 n/a
3 TRCN0000199443 GCCTTGGAAATCAAGCTTACC pLKO.1 1848 CDS 100% 4.050 3.240 N SCYL3 n/a
4 TRCN0000421417 TTTCCTTAGGCAGCTTATTTA pLKO_005 2687 3UTR 100% 15.000 10.500 N SCYL3 n/a
5 TRCN0000199556 CCTCTGGACTTGCTGTTTATC pLKO.1 207 5UTR 100% 13.200 9.240 N SCYL3 n/a
6 TRCN0000002386 CCTGTTCTCTAAATGTCAAAT pLKO.1 2823 3UTR 100% 13.200 9.240 N SCYL3 n/a
7 TRCN0000194735 CTGAGGAGTATTCAGTCAATA pLKO.1 640 CDS 100% 13.200 9.240 N SCYL3 n/a
8 TRCN0000421240 GTGCTGGGATCTATGACATAT pLKO_005 473 5UTR 100% 13.200 9.240 N SCYL3 n/a
9 TRCN0000002390 CTCCAGTTGTTTGAAGTTCAT pLKO.1 1198 CDS 100% 4.950 3.465 N SCYL3 n/a
10 TRCN0000199294 CCAACTGAAGTAGGAGACTGA pLKO.1 2378 3UTR 100% 2.640 1.848 N SCYL3 n/a
11 TRCN0000002387 GTCTGTTTATCATCTGTGTTT pLKO.1 544 5UTR 100% 4.950 2.970 N SCYL3 n/a
12 TRCN0000362319 GAGAACGAACCAAGATCTTTA pLKO_005 1415 CDS 100% 13.200 9.240 N Scyl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001864.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08709 pDONR223 100% 79.1% 79.2% None (many diffs) n/a
2 ccsbBroad304_08709 pLX_304 0% 79.1% 79.2% V5 (many diffs) n/a
3 TRCN0000473667 CCCCCCCTCGTAAGTGGTCATACA pLX_317 4.1% 79.1% 79.2% V5 (many diffs) n/a
4 ccsbBroadEn_15121 pDONR223 0% 79.1% 79.2% None (many diffs) n/a
5 ccsbBroad304_15121 pLX_304 0% 79.1% 79.2% V5 (many diffs) n/a
6 TRCN0000468898 TAACTAATTTCGTCTTAACAAGCC pLX_317 20.5% 79.1% 79.2% V5 (many diffs) n/a
7 TRCN0000489709 TTCAGTACGTTTTACAGTATGTCC pLX_317 20.5% 79.1% 79.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV