Transcript: Human XM_017001873.1

PREDICTED: Homo sapiens prostaglandin F receptor (PTGFR), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTGFR (5737)
Length:
1783
CDS:
336..1211

Additional Resources:

NCBI RefSeq record:
XM_017001873.1
NBCI Gene record:
PTGFR (5737)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001873.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358055 CTTGGACATCGAGACTATAAA pLKO_005 849 CDS 100% 15.000 21.000 N PTGFR n/a
2 TRCN0000014169 GCGGTGTATTGGAGTCACAAA pLKO.1 731 CDS 100% 4.950 6.930 N PTGFR n/a
3 TRCN0000357986 ATGGCCATTGAGCGGTGTATT pLKO_005 720 CDS 100% 13.200 10.560 N PTGFR n/a
4 TRCN0000014170 CCTGGTAATCACTGATTTCTT pLKO.1 551 CDS 100% 5.625 3.938 N PTGFR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001873.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01333 pDONR223 100% 80.1% 75.4% None (many diffs) n/a
2 ccsbBroad304_01333 pLX_304 0% 80.1% 75.4% V5 (many diffs) n/a
3 TRCN0000481111 GTTAACATTTTCCCTTTAATCATC pLX_317 43.8% 80.1% 75.4% V5 (many diffs) n/a
4 TRCN0000489925 CATCATACTGCGAACTCACATAAT pLX_317 40.7% 80.1% 75.4% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489748 CTCCGACCCGTGTTGTGCATATAA pLX_317 40.5% 80% 75.2% V5 (many diffs) n/a
Download CSV