Transcript: Human XM_017002130.2

PREDICTED: Homo sapiens signaling lymphocytic activation molecule family member 1 (SLAMF1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLAMF1 (6504)
Length:
3995
CDS:
337..1353

Additional Resources:

NCBI RefSeq record:
XM_017002130.2
NBCI Gene record:
SLAMF1 (6504)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002130.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061673 CCTCCACGTTATCTAGGAGAT pLKO.1 598 CDS 100% 4.050 5.670 N SLAMF1 n/a
2 TRCN0000373540 ACCCTTGCACCACCATATATG pLKO_005 1247 CDS 100% 13.200 10.560 N SLAMF1 n/a
3 TRCN0000061675 GATTCTCATCATGGTGGTAAT pLKO.1 1086 CDS 100% 10.800 7.560 N SLAMF1 n/a
4 TRCN0000061674 CCACTCCAGAAATTAAAGTTT pLKO.1 761 CDS 100% 5.625 3.938 N SLAMF1 n/a
5 TRCN0000061677 CAGCAACAATTCCCAGACCTT pLKO.1 981 CDS 100% 2.640 1.848 N SLAMF1 n/a
6 TRCN0000373609 CTTGGCTGGAACTGGATAATA pLKO_005 1668 3UTR 100% 15.000 9.000 N SLAMF1 n/a
7 TRCN0000373541 TGCCTGCAGTTGAGGCTTTAT pLKO_005 730 CDS 100% 13.200 7.920 N SLAMF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002130.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01539 pDONR223 100% 94.4% 92.1% None (many diffs) n/a
2 ccsbBroad304_01539 pLX_304 0% 94.4% 92.1% V5 (many diffs) n/a
3 TRCN0000480220 ACGTAATAGCCACAGACAGCGTCC pLX_317 28.3% 94.4% 92.1% V5 (many diffs) n/a
4 ccsbBroadEn_15591 pDONR223 0% 41.8% 40.7% None (many diffs) n/a
5 ccsbBroad304_15591 pLX_304 0% 41.8% 40.7% V5 (many diffs) n/a
6 TRCN0000465797 TGTGGACAGGTCCTGGGGGCTTTC pLX_317 53% 41.8% 40.7% V5 (many diffs) n/a
7 ccsbBroadEn_11133 pDONR223 100% 41.5% 37.1% None (many diffs) n/a
8 ccsbBroad304_11133 pLX_304 0% 41.5% 37.1% V5 (many diffs) n/a
9 TRCN0000478223 ACAGCACGATATGCGTTTTTCCGG pLX_317 56.8% 41.5% 37.1% V5 (many diffs) n/a
Download CSV