Transcript: Human XM_017002350.1

PREDICTED: Homo sapiens HHIP like 2 (HHIPL2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HHIPL2 (79802)
Length:
1639
CDS:
4..1464

Additional Resources:

NCBI RefSeq record:
XM_017002350.1
NBCI Gene record:
HHIPL2 (79802)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002350.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256149 ATGTCCTGAGGAACGACTATC pLKO_005 551 CDS 100% 10.800 15.120 N HHIPL2 n/a
2 TRCN0000256148 CTCGGGCTGATCCTAACAAAG pLKO_005 938 CDS 100% 10.800 15.120 N HHIPL2 n/a
3 TRCN0000167823 GTTCTGCCAATCTATGCTTAT pLKO.1 1556 3UTR 100% 10.800 15.120 N HHIPL2 n/a
4 TRCN0000167585 GATCCGAATTAGTGAGATGAA pLKO.1 912 CDS 100% 4.950 6.930 N HHIPL2 n/a
5 TRCN0000256143 CAATCGCAAGTTCTATATTTA pLKO_005 858 CDS 100% 15.000 12.000 N HHIPL2 n/a
6 TRCN0000256147 ACTGGGACATCATGGAATATT pLKO_005 248 CDS 100% 15.000 10.500 N HHIPL2 n/a
7 TRCN0000256145 AGCTGTGTGGAGATTACATTA pLKO_005 287 CDS 100% 13.200 9.240 N HHIPL2 n/a
8 TRCN0000256141 TGGATGGCTATATGTACATAT pLKO_005 1040 CDS 100% 13.200 9.240 N HHIPL2 n/a
9 TRCN0000256146 AGTCAGTCACTGGAGGTTATG pLKO_005 1593 3UTR 100% 10.800 7.560 N HHIPL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002350.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15991 pDONR223 0% 52.6% 52.6% None 1_585del;1354_1458del n/a
2 ccsbBroad304_15991 pLX_304 0% 52.6% 52.6% V5 1_585del;1354_1458del n/a
3 TRCN0000473771 TACTACAGACAATTCTCGAACTGT pLX_317 71.7% 52.6% 52.6% V5 1_585del;1354_1458del n/a
4 ccsbBroadEn_12619 pDONR223 100% 40% 39.9% None (many diffs) n/a
5 ccsbBroad304_12619 pLX_304 0% 40% 39.9% V5 (many diffs) n/a
6 TRCN0000465288 TCGGGGTTTTAGCGGAATGCCGCG pLX_317 22.8% 40% 39.9% V5 (many diffs) n/a
Download CSV