Transcript: Human XM_017002611.1

PREDICTED: Homo sapiens dispatched RND transporter family member 1 (DISP1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DISP1 (84976)
Length:
5166
CDS:
583..5157

Additional Resources:

NCBI RefSeq record:
XM_017002611.1
NBCI Gene record:
DISP1 (84976)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002611.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255593 TGTGCCTTGGTTGGAGTATTA pLKO_005 1189 CDS 100% 13.200 18.480 N DISP1 n/a
2 TRCN0000129940 GCGTTATGATGCTGAATACAA pLKO.1 2868 CDS 100% 5.625 7.875 N DISP1 n/a
3 TRCN0000127513 CCATTTCAGAAGCATCTCGAA pLKO.1 2672 CDS 100% 2.640 3.696 N DISP1 n/a
4 TRCN0000127632 CCCGAGAATAAACAAAGGGAA pLKO.1 4807 CDS 100% 2.640 3.696 N DISP1 n/a
5 TRCN0000255592 ACGTTCCAAGTGACCGATATT pLKO_005 1463 CDS 100% 13.200 10.560 N DISP1 n/a
6 TRCN0000255591 TAGACTTTGCCGTCCATTATG pLKO_005 3731 CDS 100% 13.200 10.560 N DISP1 n/a
7 TRCN0000127792 GCTGACAACTTGGAACATCAT pLKO.1 3582 CDS 100% 4.950 3.960 N DISP1 n/a
8 TRCN0000255594 TCAATTGCTGGAACGATATTT pLKO_005 3625 CDS 100% 15.000 10.500 N DISP1 n/a
9 TRCN0000255595 TGGAATTTACCTGCAATTAAA pLKO_005 1522 CDS 100% 15.000 10.500 N DISP1 n/a
10 TRCN0000255599 ATGGCAGAGCCATCGTCATTT pLKO_005 4744 CDS 100% 13.200 9.240 N DISP1 n/a
11 TRCN0000255598 GACAATGGCAACCCACTAAAT pLKO_005 2971 CDS 100% 13.200 9.240 N DISP1 n/a
12 TRCN0000255596 GTAGTATTTCACTTCGAATTT pLKO_005 2224 CDS 100% 13.200 9.240 N DISP1 n/a
13 TRCN0000255597 TAGATGGTCAGATGATCATTA pLKO_005 1386 CDS 100% 13.200 9.240 N DISP1 n/a
14 TRCN0000265675 CACCAATGTGCCACGCAAATG pLKO_005 1815 CDS 100% 10.800 7.560 N DISP1 n/a
15 TRCN0000127984 GTCAGCAATCTGGAGTTCTAT pLKO.1 3484 CDS 100% 5.625 3.938 N DISP1 n/a
16 TRCN0000131171 GCATACCGTGTGTCACTTCTT pLKO.1 4356 CDS 100% 4.950 3.465 N DISP1 n/a
17 TRCN0000127976 GCATAGAAGAGCATCTTCCAA pLKO.1 4721 CDS 100% 3.000 2.100 N DISP1 n/a
18 TRCN0000128541 CCATCATTTCAATTGCTGGAA pLKO.1 3617 CDS 100% 2.640 1.848 N DISP1 n/a
19 TRCN0000251101 TGGAATTTACCTGCAATTAAG pLKO_005 1522 CDS 100% 13.200 9.240 N Disp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002611.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12896 pDONR223 100% 60.1% 60.1% None 1_1821del;3822A>C;4222G>A n/a
2 ccsbBroad304_12896 pLX_304 0% 60.1% 60.1% V5 1_1821del;3822A>C;4222G>A n/a
3 ccsbBroadEn_12897 pDONR223 100% 35.5% 35.5% None 1627_4572del n/a
4 ccsbBroad304_12897 pLX_304 0% 35.5% 35.5% V5 1627_4572del n/a
Download CSV