Transcript: Human XM_017003110.2

PREDICTED: Homo sapiens phenylalanyl-tRNA synthetase subunit beta (FARSB), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FARSB (10056)
Length:
4347
CDS:
2747..4219

Additional Resources:

NCBI RefSeq record:
XM_017003110.2
NBCI Gene record:
FARSB (10056)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003110.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045893 CCCATTTACTTATACTGCAAA pLKO.1 2956 CDS 100% 4.950 3.960 N FARSB n/a
2 TRCN0000293732 AGCTATTGCTTATGGATATAA pLKO_005 3553 CDS 100% 15.000 10.500 N FARSB n/a
3 TRCN0000045894 CCAGTTATCTATGATAGCAAT pLKO.1 3110 CDS 100% 4.950 3.465 N FARSB n/a
4 TRCN0000045897 GCATGTGATATTGTAGAAGAT pLKO.1 3530 CDS 100% 4.950 3.465 N FARSB n/a
5 TRCN0000286285 GCATGTGATATTGTAGAAGAT pLKO_005 3530 CDS 100% 4.950 3.465 N FARSB n/a
6 TRCN0000045895 GCTGGACAGAATTATGCAGTT pLKO.1 3991 CDS 100% 4.050 2.835 N FARSB n/a
7 TRCN0000286221 GCTGGACAGAATTATGCAGTT pLKO_005 3991 CDS 100% 4.050 2.835 N FARSB n/a
8 TRCN0000045896 GCACCTACACTGACGAAGAAT pLKO.1 58 5UTR 100% 5.625 3.375 N FARSB n/a
9 TRCN0000286286 GCACCTACACTGACGAAGAAT pLKO_005 58 5UTR 100% 5.625 3.375 N FARSB n/a
10 TRCN0000163543 GCTGGGTAGTTTGACTGAAAT pLKO.1 337 5UTR 100% 13.200 6.600 Y TRIM61 n/a
11 TRCN0000161491 GCATGTGTGTAAGAAGCATAA pLKO.1 406 5UTR 100% 10.800 5.400 Y TRIM61 n/a
12 TRCN0000166802 CTTCTGTCTCTCCTGCATCAT pLKO.1 229 5UTR 100% 4.950 2.475 Y TRIM61 n/a
13 TRCN0000159764 GTAAGAAGCATAATCAGGTTT pLKO.1 414 5UTR 100% 4.950 2.475 Y TRIM61 n/a
14 TRCN0000164273 CTGCATCATTATGTCCTGGAA pLKO.1 241 5UTR 100% 2.640 1.320 Y TRIM61 n/a
15 TRCN0000166456 CTGGACTACTTGAAAGACCCA pLKO.1 185 5UTR 100% 0.660 0.330 Y TRIM61 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003110.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07541 pDONR223 100% 83% 83% None 0_1ins297;1356C>T;1456G>A n/a
2 ccsbBroad304_07541 pLX_304 0% 83% 83% V5 0_1ins297;1356C>T;1456G>A n/a
3 TRCN0000480760 TCTAATCCCGCACTTGCATAGATT pLX_317 22.5% 83% 83% V5 0_1ins297;1356C>T;1456G>A n/a
Download CSV