Transcript: Human XM_017003352.1

PREDICTED: Homo sapiens pleckstrin homology, MyTH4 and FERM domain containing H2 (PLEKHH2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLEKHH2 (130271)
Length:
3153
CDS:
84..3125

Additional Resources:

NCBI RefSeq record:
XM_017003352.1
NBCI Gene record:
PLEKHH2 (130271)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003352.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420264 CAAGATCTGGAGTCGCTAATA pLKO_005 348 CDS 100% 13.200 18.480 N PLEKHH2 n/a
2 TRCN0000415601 ATATTGGAAGAGTGGATTAAA pLKO_005 2433 CDS 100% 15.000 10.500 N PLEKHH2 n/a
3 TRCN0000426041 GAGTTGTGATGATGGATTATT pLKO_005 1598 CDS 100% 15.000 10.500 N PLEKHH2 n/a
4 TRCN0000426938 TGAATCAGAGACAAGATTATA pLKO_005 317 CDS 100% 15.000 10.500 N PLEKHH2 n/a
5 TRCN0000150325 CCTTCAATATGGAGAGTGTTA pLKO.1 1783 CDS 100% 4.950 3.465 N PLEKHH2 n/a
6 TRCN0000154671 GCAAGCAAGATACGAGAGCTT pLKO.1 174 CDS 100% 2.640 1.848 N PLEKHH2 n/a
7 TRCN0000151395 GCCATATTGAACTTAGTGCAT pLKO.1 2323 CDS 100% 2.640 1.848 N PLEKHH2 n/a
8 TRCN0000153696 CCAGCTTTAATGCCAAAGCAT pLKO.1 1320 CDS 100% 0.300 0.210 N PLEKHH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003352.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13153 pDONR223 100% 77.9% 76.2% None (many diffs) n/a
2 ccsbBroad304_13153 pLX_304 0% 77.9% 76.2% V5 (many diffs) n/a
3 TRCN0000468831 AGTTTTTGTAGCATGAACATAAGC pLX_317 17.5% 77.9% 76.2% V5 (many diffs) n/a
Download CSV