Transcript: Human XM_017003398.1

PREDICTED: Homo sapiens coiled-coil domain containing 148 (CCDC148), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC148 (130940)
Length:
2215
CDS:
322..1458

Additional Resources:

NCBI RefSeq record:
XM_017003398.1
NBCI Gene record:
CCDC148 (130940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003398.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149332 GAAAGGCGTTTGATGGAGAAA pLKO.1 1078 CDS 100% 4.950 6.930 N CCDC148 n/a
2 TRCN0000420705 ATGGAAGCTTCATTATCATTA pLKO_005 1855 3UTR 100% 13.200 9.240 N CCDC148 n/a
3 TRCN0000431948 GAACTTAATTATGGCACATAT pLKO_005 1681 3UTR 100% 13.200 9.240 N CCDC148 n/a
4 TRCN0000148734 CCTCACAAATCTAGGCATGAT pLKO.1 523 CDS 100% 4.950 3.465 N CCDC148 n/a
5 TRCN0000147084 CCTGTTAGAATGATGTCAGAT pLKO.1 1195 CDS 100% 4.950 3.465 N CCDC148 n/a
6 TRCN0000149389 GTAGCAAGACTGGAAATGGAA pLKO.1 823 CDS 100% 3.000 2.100 N CCDC148 n/a
7 TRCN0000128806 CTTAGGAAACAGGTTGCTGTT pLKO.1 1159 CDS 100% 0.405 0.284 N CCDC148 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003398.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14378 pDONR223 100% 78% 74.7% None (many diffs) n/a
2 ccsbBroad304_14378 pLX_304 0% 78% 74.7% V5 (many diffs) n/a
3 TRCN0000472539 TCCTATATCCCGTTATGGATGAAT pLX_317 36.4% 78% 74.7% V5 (many diffs) n/a
Download CSV