Transcript: Human XM_017003523.2

PREDICTED: Homo sapiens dynein axonemal heavy chain 6 (DNAH6), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAH6 (1768)
Length:
11804
CDS:
410..11623

Additional Resources:

NCBI RefSeq record:
XM_017003523.2
NBCI Gene record:
DNAH6 (1768)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003523.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168637 GCCATTATCTTTGAGGCACAA pLKO.1 1268 CDS 100% 4.050 2.835 N DNAH6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003523.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10784 pDONR223 100% 14.5% 14.2% None (many diffs) n/a
2 ccsbBroad304_10784 pLX_304 0% 14.5% 14.2% V5 (many diffs) n/a
3 ccsbBroadEn_10785 pDONR223 100% 10.8% 10.8% None (many diffs) n/a
4 ccsbBroad304_10785 pLX_304 0% 10.8% 10.8% V5 (many diffs) n/a
5 TRCN0000480563 AAGCCTACTAACCAGATTTTATTC pLX_317 32% 10.8% 10.8% V5 (many diffs) n/a
Download CSV