Transcript: Human XM_017003899.1

PREDICTED: Homo sapiens growth factor receptor bound protein 14 (GRB14), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRB14 (2888)
Length:
1824
CDS:
579..1601

Additional Resources:

NCBI RefSeq record:
XM_017003899.1
NBCI Gene record:
GRB14 (2888)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061601 CAACTCAATAAGGGCGTTCTT pLKO.1 1539 CDS 100% 4.950 6.930 N GRB14 n/a
2 TRCN0000310546 CAACTCAATAAGGGCGTTCTT pLKO_005 1539 CDS 100% 4.950 6.930 N GRB14 n/a
3 TRCN0000303802 AGCCAGAAGTGACTTATTAAA pLKO_005 1605 3UTR 100% 15.000 10.500 N GRB14 n/a
4 TRCN0000303857 AGTAGAAGATGACGGTGAAAT pLKO_005 1454 CDS 100% 13.200 9.240 N GRB14 n/a
5 TRCN0000061599 CCTGAAATTCATGGTTTCTTA pLKO.1 681 CDS 100% 5.625 3.938 N GRB14 n/a
6 TRCN0000300082 CCTGAAATTCATGGTTTCTTA pLKO_005 681 CDS 100% 5.625 3.938 N GRB14 n/a
7 TRCN0000061602 GCGATTAGATTGCTTAAGTAT pLKO.1 984 CDS 100% 5.625 3.938 N GRB14 n/a
8 TRCN0000061598 CCAGAATTATATGCATCCATA pLKO.1 1019 CDS 100% 4.950 2.970 N GRB14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000478548 GGTTAAGATAAAGCCTCCCTTCAA pLX_317 25.3% 62.9% 62.9% V5 0_1ins600 n/a
2 ccsbBroadEn_06325 pDONR223 100% 62.9% 62.7% None 0_1ins600;1012A>N n/a
3 ccsbBroad304_06325 pLX_304 0% 62.9% 62.7% V5 0_1ins600;1012A>N n/a
Download CSV