Transcript: Human XM_017003944.1

PREDICTED: Homo sapiens annexin A4 (ANXA4), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANXA4 (307)
Length:
3270
CDS:
1611..2324

Additional Resources:

NCBI RefSeq record:
XM_017003944.1
NBCI Gene record:
ANXA4 (307)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381770 ACCGATGAAGACGCCATTATT pLKO_005 1458 5UTR 100% 15.000 21.000 N ANXA4 n/a
2 TRCN0000303434 GGATATTGAACAGAGTATTAA pLKO_005 2018 CDS 100% 15.000 21.000 N ANXA4 n/a
3 TRCN0000379798 TGTAAGCATCCGGTCAGTAAG pLKO_005 2747 3UTR 100% 10.800 15.120 N ANXA4 n/a
4 TRCN0000056281 GCCTTGAAGATGACATTCGCT pLKO.1 1768 CDS 100% 0.750 1.050 N ANXA4 n/a
5 TRCN0000299122 GCCTTGAAGATGACATTCGCT pLKO_005 1768 CDS 100% 0.750 1.050 N ANXA4 n/a
6 TRCN0000056279 GACGCCATTATTAGCGTCCTT pLKO.1 1467 5UTR 100% 0.264 0.370 N ANXA4 n/a
7 TRCN0000380134 TGCTCTGCTGGCTATAGTAAA pLKO_005 2066 CDS 100% 13.200 10.560 N ANXA4 n/a
8 TRCN0000056282 GCTGGCTATAGTAAAGTGCAT pLKO.1 2072 CDS 100% 2.640 2.112 N ANXA4 n/a
9 TRCN0000310693 TCTACACTGCTATTATCATTA pLKO_005 2386 3UTR 100% 13.200 9.240 N ANXA4 n/a
10 TRCN0000056278 GCACACTTCAAGAGACTCTAT pLKO.1 2217 CDS 100% 4.950 3.465 N ANXA4 n/a
11 TRCN0000310379 GCACACTTCAAGAGACTCTAT pLKO_005 2217 CDS 100% 4.950 3.465 N ANXA4 n/a
12 TRCN0000056280 GCAGAAATTGACATGTTGGAT pLKO.1 2190 CDS 100% 3.000 2.100 N ANXA4 n/a
13 TRCN0000299174 GCAGAAATTGACATGTTGGAT pLKO_005 2190 CDS 100% 3.000 2.100 N ANXA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10679 pDONR223 100% 77.3% 75.2% None (many diffs) n/a
2 ccsbBroad304_10679 pLX_304 0% 77.3% 75.2% V5 (many diffs) n/a
3 TRCN0000466123 CATAATTGTGCCATGTGGCCTGCG pLX_317 46.3% 77.3% 75.2% V5 (many diffs) n/a
4 ccsbBroadEn_00069 pDONR223 100% 73.8% 73.8% None 0_1ins252 n/a
5 ccsbBroad304_00069 pLX_304 0% 73.8% 73.8% V5 0_1ins252 n/a
6 TRCN0000473823 TCTACCTAGATTGAAATAGACTAA pLX_317 51.1% 73.8% 73.8% V5 0_1ins252 n/a
Download CSV