Transcript: Human XM_017003981.2

PREDICTED: Homo sapiens cyclin dependent kinase like 4 (CDKL4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDKL4 (344387)
Length:
2879
CDS:
277..1305

Additional Resources:

NCBI RefSeq record:
XM_017003981.2
NBCI Gene record:
CDKL4 (344387)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003981.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358265 ATGGTTCTTCAGTCGATATAT pLKO_005 809 CDS 100% 15.000 21.000 N CDKL4 n/a
2 TRCN0000021521 CCGATTATGTAGCTACGAGAT pLKO.1 749 CDS 100% 4.050 5.670 N CDKL4 n/a
3 TRCN0000021523 GTATGGTTCTTCAGTCGATAT pLKO.1 807 CDS 100% 10.800 8.640 N CDKL4 n/a
4 TRCN0000358262 ACGTATGTTGAAGCAATTAAA pLKO_005 432 CDS 100% 15.000 10.500 N CDKL4 n/a
5 TRCN0000358263 GAGATGCCTACACCGATTATG pLKO_005 737 CDS 100% 13.200 9.240 N CDKL4 n/a
6 TRCN0000021520 CCAAGACATCAATCAATCTTT pLKO.1 940 CDS 100% 5.625 3.938 N CDKL4 n/a
7 TRCN0000021522 CTGAAGATGATCCTGTTGTTA pLKO.1 389 CDS 100% 5.625 3.938 N CDKL4 n/a
8 TRCN0000196305 GAGCTCCTACTTTGATTCTTT pLKO.1 1122 CDS 100% 5.625 3.938 N CDKL4 n/a
9 TRCN0000195080 CCAAATCTTGTGAACCTCATC pLKO.1 457 CDS 100% 4.050 2.835 N CDKL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003981.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467405 GCGTACAAATGTAGATCTTTTTCC pLX_317 30.2% 90.8% 19.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15308 pDONR223 100% 90.5% 19.5% None (many diffs) n/a
3 ccsbBroad304_15308 pLX_304 0% 90.5% 19.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV