Transcript: Human XM_017003985.1

PREDICTED: Homo sapiens cyclin dependent kinase like 4 (CDKL4), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDKL4 (344387)
Length:
2551
CDS:
1417..1944

Additional Resources:

NCBI RefSeq record:
XM_017003985.1
NBCI Gene record:
CDKL4 (344387)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146173 AAATCTTGTGAACCTCATCG pXPR_003 AGG 199 38% 3 0.6303 CDKL4 CDKL4 76106
2 BRDN0001149476 AATATTCTAATAACTAAGCA pXPR_003 AGG 407 77% 5 -0.2026 CDKL4 CDKL4 76108
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003985.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358262 ACGTATGTTGAAGCAATTAAA pLKO_005 1572 CDS 100% 15.000 10.500 N CDKL4 n/a
2 TRCN0000021522 CTGAAGATGATCCTGTTGTTA pLKO.1 1529 CDS 100% 5.625 3.938 N CDKL4 n/a
3 TRCN0000195080 CCAAATCTTGTGAACCTCATC pLKO.1 1597 CDS 100% 4.050 2.835 N CDKL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003985.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467405 GCGTACAAATGTAGATCTTTTTCC pLX_317 30.2% 53.2% 38% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15308 pDONR223 100% 53.1% 38% None (many diffs) n/a
3 ccsbBroad304_15308 pLX_304 0% 53.1% 38% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV