Transcript: Human XM_017003995.1

PREDICTED: Homo sapiens inositol polyphosphate-4-phosphatase type I A (INPP4A), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INPP4A (3631)
Length:
12588
CDS:
389..3220

Additional Resources:

NCBI RefSeq record:
XM_017003995.1
NBCI Gene record:
INPP4A (3631)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003995.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231459 TACAGAGGGCCCTCGTTTAAA pLKO_005 1331 CDS 100% 15.000 21.000 N INPP4A n/a
2 TRCN0000231460 AGGTTTGGCGATACGTCTTTA pLKO_005 2672 CDS 100% 13.200 18.480 N INPP4A n/a
3 TRCN0000231458 CGATCCAAATACGCTTCATTG pLKO_005 1013 CDS 100% 10.800 15.120 N INPP4A n/a
4 TRCN0000000540 CTCTTCAACGTGGGCATCAAT pLKO.1 2630 CDS 100% 5.625 7.875 N INPP4A n/a
5 TRCN0000001318 CTCTTCAACGTGGGCATCAAT pLKO.1 2630 CDS 100% 5.625 7.875 N INPP4A n/a
6 TRCN0000000538 CCAGACCATCATCCTCACATA pLKO.1 1282 CDS 100% 4.950 6.930 N INPP4A n/a
7 TRCN0000001316 CCAGACCATCATCCTCACATA pLKO.1 1282 CDS 100% 4.950 6.930 N INPP4A n/a
8 TRCN0000000542 CCGGAAGAATAAGAACGTCGA pLKO.1 2842 CDS 100% 2.160 3.024 N INPP4A n/a
9 TRCN0000001319 CCGGAAGAATAAGAACGTCGA pLKO.1 2842 CDS 100% 2.160 3.024 N INPP4A n/a
10 TRCN0000231457 GGGAACCAACAATCCTATATT pLKO_005 658 CDS 100% 15.000 12.000 N INPP4A n/a
11 TRCN0000000541 CTCTGTTCCATCCCTTTATTA pLKO.1 3122 CDS 100% 15.000 10.500 N INPP4A n/a
12 TRCN0000231461 GAGAGTTTGGTGCGGTTAAAT pLKO_005 2711 CDS 100% 15.000 10.500 N INPP4A n/a
13 TRCN0000000539 CTCTCCGTGTATGATGTCAAA pLKO.1 737 CDS 100% 4.950 3.465 N INPP4A n/a
14 TRCN0000001317 CTCTCCGTGTATGATGTCAAA pLKO.1 737 CDS 100% 4.950 3.465 N INPP4A n/a
15 TRCN0000001320 GATGAGTGACAAGGCCAAGAA pLKO.1 2167 CDS 100% 4.950 2.970 N INPP4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003995.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06455 pDONR223 100% 90.1% 87.7% None (many diffs) n/a
2 ccsbBroad304_06455 pLX_304 0% 90.1% 87.7% V5 (many diffs) n/a
3 TRCN0000478942 CTGGATTGAAGGTTCCATGGACCA pLX_317 13.6% 90.1% 87.7% V5 (many diffs) n/a
Download CSV