Transcript: Human XM_017004529.1

PREDICTED: Homo sapiens tetratricopeptide repeat domain 7A (TTC7A), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC7A (57217)
Length:
2604
CDS:
312..2504

Additional Resources:

NCBI RefSeq record:
XM_017004529.1
NBCI Gene record:
TTC7A (57217)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130278 CGATGACTTTGGGAAATTGCT pLKO.1 494 CDS 100% 3.000 4.200 N TTC7A n/a
2 TRCN0000131173 GCAAGATGAATTGCACCGGAA pLKO.1 1838 CDS 100% 2.160 3.024 N TTC7A n/a
3 TRCN0000128934 CCAAAGCAACTCAGAACTTCA pLKO.1 1129 CDS 100% 4.950 3.465 N TTC7A n/a
4 TRCN0000128543 CGTTTGGAGAATTTCACCTTT pLKO.1 1540 CDS 100% 4.950 3.465 N TTC7A n/a
5 TRCN0000129208 CTGAAGTCCAAGCAAGATGAA pLKO.1 1827 CDS 100% 4.950 3.465 N TTC7A n/a
6 TRCN0000129572 CGAGCCATGAAGTTTGCGTTT pLKO.1 1524 CDS 100% 4.050 2.835 N TTC7A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12338 pDONR223 100% 43.2% 42.1% None (many diffs) n/a
2 ccsbBroad304_12338 pLX_304 0% 43.2% 42.1% V5 (many diffs) n/a
3 TRCN0000480913 CCACGCTACAAGCTGTTAGGAAGT pLX_317 26.4% 43.2% 42.1% V5 (many diffs) n/a
Download CSV