Transcript: Human XM_017004627.2

PREDICTED: Homo sapiens REL proto-oncogene, NF-kB subunit (REL), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
REL (5966)
Length:
7634
CDS:
321..2015

Additional Resources:

NCBI RefSeq record:
XM_017004627.2
NBCI Gene record:
REL (5966)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004627.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428686 ACAACAATGCCGATGACATAG pLKO_005 1543 CDS 100% 10.800 15.120 N REL n/a
2 TRCN0000420389 GTATGTCAGCAGGCGCCAATT pLKO_005 1783 CDS 100% 10.800 15.120 N REL n/a
3 TRCN0000416491 GACCATCAAACAGTACTAATC pLKO_005 1891 CDS 100% 10.800 8.640 N REL n/a
4 TRCN0000039983 CCACCTATATAGATGCAGCAT pLKO.1 2049 3UTR 100% 2.640 2.112 N REL n/a
5 TRCN0000039987 GCAGATAACAGCATGATAAAT pLKO.1 1863 CDS 100% 15.000 10.500 N REL n/a
6 TRCN0000430620 AGCAGATTTATATGGTATTTC pLKO_005 1592 CDS 100% 13.200 9.240 N REL n/a
7 TRCN0000435450 CATACCCTTCTATCCAGATTA pLKO_005 457 CDS 100% 13.200 9.240 N REL n/a
8 TRCN0000433863 AGTGAGAATTACATTAGTAAC pLKO_005 500 CDS 100% 10.800 7.560 N REL n/a
9 TRCN0000424900 ATAGTCAGTATTCAGGTATTG pLKO_005 1936 CDS 100% 10.800 7.560 N REL n/a
10 TRCN0000435698 CAACTTTGGACATAGCGAATA pLKO_005 2186 3UTR 100% 10.800 7.560 N REL n/a
11 TRCN0000039986 CCAGGAAGTTAGTGAATCTAT pLKO.1 1124 CDS 100% 5.625 3.938 N REL n/a
12 TRCN0000039984 GCAGGAATCAATCCATTCAAT pLKO.1 693 CDS 100% 5.625 3.938 N REL n/a
13 TRCN0000414851 CTGACTGAGAATATAATACTG pLKO_005 2124 3UTR 100% 4.950 3.465 N REL n/a
14 TRCN0000010421 CTTCAGTTGTGCAGATAACAG pLKO.1 1853 CDS 100% 4.950 3.465 N REL n/a
15 TRCN0000039985 GCTGTCTAATTGTTCTGTGAA pLKO.1 1625 CDS 100% 4.950 3.465 N REL n/a
16 TRCN0000010420 GAAGATTGTGACCTCAATGTG pLKO.1 741 CDS 100% 4.950 2.970 N REL n/a
17 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 7535 3UTR 100% 4.950 2.475 Y ERAP2 n/a
18 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7536 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004627.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11094 pDONR223 100% 96% 96% None 921_922ins69 n/a
2 ccsbBroad304_11094 pLX_304 0% 96% 96% V5 921_922ins69 n/a
3 TRCN0000481578 CGCACCACACATAGACTCAAGCCC pLX_317 25.6% 96% 96% V5 921_922ins69 n/a
Download CSV