Transcript: Human XM_017004770.2

PREDICTED: Homo sapiens solute carrier family 20 member 1 (SLC20A1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC20A1 (6574)
Length:
3357
CDS:
1277..2557

Additional Resources:

NCBI RefSeq record:
XM_017004770.2
NBCI Gene record:
SLC20A1 (6574)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043057 CCATCAGTACAACACATTGTA pLKO.1 2373 CDS 100% 0.563 0.788 N SLC20A1 n/a
2 TRCN0000289801 CCATCAGTACAACACATTGTA pLKO_005 2373 CDS 100% 0.563 0.788 N SLC20A1 n/a
3 TRCN0000296390 CTCACATGCACAGGGATTTAA pLKO_005 2966 3UTR 100% 15.000 10.500 N SLC20A1 n/a
4 TRCN0000043055 CCAGTATCACACCGTGCATAA pLKO.1 1645 CDS 100% 10.800 7.560 N SLC20A1 n/a
5 TRCN0000289800 CCAGTATCACACCGTGCATAA pLKO_005 1645 CDS 100% 10.800 7.560 N SLC20A1 n/a
6 TRCN0000043053 GCCCTTATCGTCTGGTTCTTT pLKO.1 1244 5UTR 100% 5.625 3.938 N SLC20A1 n/a
7 TRCN0000306853 GCCCTTATCGTCTGGTTCTTT pLKO_005 1244 5UTR 100% 5.625 3.938 N SLC20A1 n/a
8 TRCN0000043054 CCTGGGCTTCATTATTGCATT pLKO.1 536 5UTR 100% 4.950 3.465 N SLC20A1 n/a
9 TRCN0000043056 CCCATTGTATTGTTGGTGCAA pLKO.1 847 5UTR 100% 2.640 1.848 N SLC20A1 n/a
10 TRCN0000289734 CCCATTGTATTGTTGGTGCAA pLKO_005 847 5UTR 100% 2.640 1.848 N SLC20A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01551 pDONR223 100% 62.7% 62.7% None 0_1ins759 n/a
2 ccsbBroad304_01551 pLX_304 0% 62.7% 62.7% V5 0_1ins759 n/a
3 TRCN0000479800 ACTTAGTCTTTACCCATGGCTTCA pLX_317 9.1% 62.7% 62.7% V5 0_1ins759 n/a
Download CSV