Transcript: Human XM_017004778.2

PREDICTED: Homo sapiens spastin (SPAST), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPAST (6683)
Length:
4194
CDS:
282..1841

Additional Resources:

NCBI RefSeq record:
XM_017004778.2
NBCI Gene record:
SPAST (6683)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004778.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423345 TGTAATGGGTGCAACTAATAG pLKO_005 1628 CDS 100% 13.200 18.480 N SPAST n/a
2 TRCN0000119008 CGATGCTAGTAGACGCCTAAA pLKO.1 1550 CDS 100% 10.800 15.120 N SPAST n/a
3 TRCN0000119010 CCCTCAAACTTTAGAAGCGTA pLKO.1 1905 3UTR 100% 2.640 3.696 N SPAST n/a
4 TRCN0000119011 GCGTTTCATCAAACGGGTATA pLKO.1 1679 CDS 100% 1.080 1.512 N SPAST n/a
5 TRCN0000421045 GATGAGAAATATTCGATTATC pLKO_005 1842 CDS 100% 13.200 10.560 N SPAST n/a
6 TRCN0000119007 GCCCTTAGTTTACTGGTTAAA pLKO.1 3237 3UTR 100% 13.200 10.560 N SPAST n/a
7 TRCN0000119009 CGAGAACTTCAACCTTCTATA pLKO.1 1476 CDS 100% 13.200 9.240 N SPAST n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3763 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3763 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004778.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01585 pDONR223 100% 88.8% 87.1% None 1518_1519ins71;1557_1558ins124 n/a
2 ccsbBroad304_01585 pLX_304 0% 88.8% 87.1% V5 1518_1519ins71;1557_1558ins124 n/a
3 TRCN0000478063 CTGGGAGATCTCTGGGCAATCGTG pLX_317 25.4% 88.8% 87.1% V5 1518_1519ins71;1557_1558ins124 n/a
Download CSV