Transcript: Human XM_017004894.2

PREDICTED: Homo sapiens melanophilin (MLPH), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MLPH (79083)
Length:
1934
CDS:
212..1783

Additional Resources:

NCBI RefSeq record:
XM_017004894.2
NBCI Gene record:
MLPH (79083)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004894.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127661 CAGTACAACAGGACCACAGAT pLKO.1 1484 CDS 100% 4.950 3.960 N MLPH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004894.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04044 pDONR223 100% 87.8% 86.3% None (many diffs) n/a
2 ccsbBroad304_04044 pLX_304 0% 87.8% 86.3% V5 (many diffs) n/a
3 TRCN0000467668 CGAGCACGGACTCTCTCACACTCG pLX_317 22.5% 87.8% 86.3% V5 (many diffs) n/a
4 ccsbBroadEn_04043 pDONR223 100% 83.7% 82.3% None (many diffs) n/a
5 ccsbBroad304_04043 pLX_304 0% 83.7% 82.3% V5 (many diffs) n/a
6 TRCN0000479827 CCTACAGCTACGCAATGAGCTCCC pLX_317 21.5% 83.7% 82.3% V5 (many diffs) n/a
Download CSV