Transcript: Human XM_017005056.2

PREDICTED: Homo sapiens ILK associated serine/threonine phosphatase (ILKAP), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ILKAP (80895)
Length:
1395
CDS:
443..1261

Additional Resources:

NCBI RefSeq record:
XM_017005056.2
NBCI Gene record:
ILKAP (80895)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231636 CATTACTCGGGTTTCATATTT pLKO_005 505 CDS 100% 15.000 21.000 N ILKAP n/a
2 TRCN0000231638 GGCAATCTTGTGTCGTTATAA pLKO_005 796 CDS 100% 15.000 21.000 N ILKAP n/a
3 TRCN0000231637 TATTGCCAACCTCGGAGATAG pLKO_005 772 CDS 100% 10.800 15.120 N ILKAP n/a
4 TRCN0000002651 CCTCATTACTCGGGTTTCATA pLKO.1 502 CDS 100% 5.625 7.875 N ILKAP n/a
5 TRCN0000199339 CCGCTAGCAGTGGCGATTCAG pLKO.1 250 5UTR 100% 0.000 0.000 N ILKAP n/a
6 TRCN0000231639 ATGGGCTCTTCAAGGTCTTTA pLKO_005 1059 CDS 100% 13.200 9.240 N ILKAP n/a
7 TRCN0000002655 AGAGCGGATGAGGATACAGAA pLKO.1 880 CDS 100% 4.950 3.465 N ILKAP n/a
8 TRCN0000002654 AGTGGCGATTCAGGTTCTCTT pLKO.1 258 5UTR 100% 4.950 3.465 N ILKAP n/a
9 TRCN0000197028 GAGCACGCATGGTATTGACTT pLKO.1 1280 3UTR 100% 4.950 3.465 N ILKAP n/a
10 TRCN0000002652 TCAGCAAAGAGCATAATCCAA pLKO.1 849 CDS 100% 3.000 2.100 N ILKAP n/a
11 TRCN0000002653 CTTCATCTTGTCCTGTCTCGA pLKO.1 1099 CDS 100% 2.640 1.584 N ILKAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04228 pDONR223 100% 69.3% 69.3% None 0_1ins360 n/a
2 ccsbBroad304_04228 pLX_304 0% 69.3% 69.3% V5 0_1ins360 n/a
3 TRCN0000472884 GGGCGTGTACAGTAACTTCTGCAG pLX_317 45% 69.3% 69.3% V5 0_1ins360 n/a
Download CSV