Transcript: Human XM_017005059.1

PREDICTED: Homo sapiens LBH regulator of WNT signaling pathway (LBH), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LBH (81606)
Length:
3091
CDS:
16..684

Additional Resources:

NCBI RefSeq record:
XM_017005059.1
NBCI Gene record:
LBH (81606)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107526 CTATCTGAGATCGGCCAAGAT pLKO.1 399 CDS 100% 4.950 6.930 N LBH n/a
2 TRCN0000422538 TGTGGACTCCCATGGGTCATA pLKO_005 691 3UTR 100% 4.950 6.930 N LBH n/a
3 TRCN0000107525 GCTTGTAAACTGCGTAACAAA pLKO.1 2667 3UTR 100% 5.625 3.938 N LBH n/a
4 TRCN0000429633 GAGAGTGAGCCGCAATTGTTC pLKO_005 762 3UTR 100% 4.950 3.465 N LBH n/a
5 TRCN0000107527 GATGAGCAAGATAACTGCGAA pLKO.1 634 CDS 100% 2.640 1.848 N LBH n/a
6 TRCN0000107528 GATGATGAACACCCAGCCCAT pLKO.1 429 CDS 100% 2.160 1.512 N LBH n/a
7 TRCN0000107529 GCGAAGAGACAGCGAAAGAAA pLKO.1 650 CDS 100% 5.625 3.375 N LBH n/a
8 TRCN0000095613 CGCAAGGATGGCCTTTCCTAT pLKO.1 472 CDS 100% 4.950 3.465 N Lbh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04245 pDONR223 100% 42.1% 42.3% None 1_375del;376_377ins24 n/a
2 ccsbBroad304_04245 pLX_304 0% 42.1% 42.3% V5 1_375del;376_377ins24 n/a
3 TRCN0000468543 TTGACTTTCGAGAACTGCCCGCTA pLX_317 100% 42.1% 42.3% V5 1_375del;376_377ins24 n/a
Download CSV