Transcript: Human XM_017005090.2

PREDICTED: Homo sapiens rhomboid domain containing 1 (RHBDD1), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHBDD1 (84236)
Length:
5542
CDS:
913..1860

Additional Resources:

NCBI RefSeq record:
XM_017005090.2
NBCI Gene record:
RHBDD1 (84236)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005090.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075231 GCTCTGGATATCAGGATTATT pLKO.1 1628 CDS 100% 15.000 21.000 N RHBDD1 n/a
2 TRCN0000075232 AGGACGGCAATACTACTTTAA pLKO.1 1596 CDS 100% 13.200 18.480 N RHBDD1 n/a
3 TRCN0000430006 CGAACTTGTGGCTATTCATTT pLKO_005 1446 CDS 100% 13.200 18.480 N RHBDD1 n/a
4 TRCN0000075229 GCCTATGTTATCACCGCATTT pLKO.1 1225 CDS 100% 10.800 15.120 N RHBDD1 n/a
5 TRCN0000438489 GCGGCTTCACAGATTCGATAG pLKO_005 1833 CDS 100% 6.000 8.400 N RHBDD1 n/a
6 TRCN0000075228 CGGGAAGATTAGTCCCTCATT pLKO.1 2208 3UTR 100% 4.950 6.930 N RHBDD1 n/a
7 TRCN0000430750 TTTCCTGTACCGAACAGATTT pLKO_005 1414 CDS 100% 13.200 10.560 N RHBDD1 n/a
8 TRCN0000419347 GACATGGCCTATTCGTGTAAT pLKO_005 1877 3UTR 100% 13.200 9.240 N RHBDD1 n/a
9 TRCN0000414950 CCTTCACCATGCTGATGATTG pLKO_005 1128 CDS 100% 10.800 7.560 N RHBDD1 n/a
10 TRCN0000435031 GTACTTACTGGAGTGGTATAC pLKO_005 1249 CDS 100% 10.800 7.560 N RHBDD1 n/a
11 TRCN0000075230 GCTGGGATTCTTGTTGGACTA pLKO.1 1501 CDS 100% 4.050 2.835 N RHBDD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005090.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04344 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04344 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468802 CATACGCTCTCGGCTAAGAACCAA pLX_317 15.9% 100% 100% V5 n/a
4 ccsbBroadEn_12796 pDONR223 100% 32.9% 31.7% None (many diffs) n/a
5 ccsbBroad304_12796 pLX_304 0% 32.9% 31.7% V5 (many diffs) n/a
6 TRCN0000472049 GTTTGGATTGACCCCTTGCGAGGA pLX_317 100% 32.9% 31.7% V5 (many diffs) n/a
Download CSV