Transcript: Human XM_017005723.1

PREDICTED: Homo sapiens methyltransferase like 6 (METTL6), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
METTL6 (131965)
Length:
3658
CDS:
264..827

Additional Resources:

NCBI RefSeq record:
XM_017005723.1
NBCI Gene record:
METTL6 (131965)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152034 CCAAACTTTGGTGTCTGATTT pLKO.1 338 CDS 100% 13.200 10.560 N METTL6 n/a
2 TRCN0000157967 CCAGAGAGTTTGAGGAGCTAA pLKO.1 454 CDS 100% 4.950 3.465 N METTL6 n/a
3 TRCN0000152989 GACCAAACTTTGGTGTCTGAT pLKO.1 336 CDS 100% 4.950 3.465 N METTL6 n/a
4 TRCN0000151394 GATGATCTTCTGGATCATGTA pLKO.1 546 CDS 100% 0.495 0.347 N METTL6 n/a
5 TRCN0000156879 GCAAGGATTCTCACCTCTGAA pLKO.1 294 CDS 100% 4.950 2.970 N METTL6 n/a
6 TRCN0000152400 GATACAGAAAGATGCAAGGTA pLKO.1 504 CDS 100% 3.000 1.800 N METTL6 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2500 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000150694 GCTAAGATCATGTAGAGAGTT pLKO.1 470 CDS 100% 4.950 3.465 N METTL6 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2500 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13166 pDONR223 100% 61.5% 55.3% None (many diffs) n/a
2 ccsbBroad304_13166 pLX_304 0% 61.5% 55.3% V5 (many diffs) n/a
3 TRCN0000472430 GCATCTCCCCTCTCATTAAAATCA pLX_317 46.7% 61.5% 55.3% V5 (many diffs) n/a
Download CSV