Transcript: Human XM_017005856.2

PREDICTED: Homo sapiens 3-hydroxyacyl-CoA dehydratase 2 (HACD2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HACD2 (201562)
Length:
3037
CDS:
73..465

Additional Resources:

NCBI RefSeq record:
XM_017005856.2
NBCI Gene record:
HACD2 (201562)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005856.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030088 GCTACCATAGCCTTTATTATT pLKO.1 278 CDS 100% 15.000 10.500 N Hacd2 n/a
2 TRCN0000030086 GCGTACCTGGTCATCTACAAT pLKO.1 190 CDS 100% 5.625 3.938 N Hacd2 n/a
3 TRCN0000160585 CTATAGGAATTGTTCCATCTT pLKO.1 359 CDS 100% 4.950 3.465 N HACD2 n/a
4 TRCN0000030085 CCTGACTTCTTTCCAGGTGAT pLKO.1 387 CDS 100% 4.050 2.835 N Hacd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005856.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05198 pDONR223 100% 51% 50.3% None (many diffs) n/a
2 ccsbBroad304_05198 pLX_304 0% 51% 50.3% V5 (many diffs) n/a
3 TRCN0000466043 TCTCGACATAGAGGAGGGGCTGAC pLX_317 47.3% 51% 50.3% V5 (many diffs) n/a
Download CSV