Transcript: Human XM_017005866.2

PREDICTED: Homo sapiens EPH receptor B1 (EPHB1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPHB1 (2047)
Length:
4837
CDS:
374..3490

Additional Resources:

NCBI RefSeq record:
XM_017005866.2
NBCI Gene record:
EPHB1 (2047)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005866.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378232 ACTATGAGATCCGGTACTATG pLKO_005 1932 CDS 100% 10.800 15.120 N EPHB1 n/a
2 TRCN0000000818 GCCTCTTACTCGGAATGGTTT pLKO.1 871 CDS 100% 4.950 6.930 N EPHB1 n/a
3 TRCN0000355606 CACCTGTCGGACCGGTTATTA pLKO_005 1276 CDS 100% 15.000 12.000 N EPHB1 n/a
4 TRCN0000355608 CTGCGATGGAAGAAACGTTAA pLKO_005 420 CDS 100% 10.800 8.640 N EPHB1 n/a
5 TRCN0000000819 GCTGCGATGGAAGAAACGTTA pLKO.1 419 CDS 100% 4.950 3.960 N EPHB1 n/a
6 TRCN0000195710 CCTGAGAATAGGCATCACCTT pLKO.1 3388 CDS 100% 2.640 2.112 N EPHB1 n/a
7 TRCN0000197015 GACTCTGACTGACGATGATTA pLKO.1 2107 CDS 100% 13.200 9.240 N EPHB1 n/a
8 TRCN0000355550 GTAGCAGGAAACGGGCTTATA pLKO_005 2223 CDS 100% 13.200 9.240 N EPHB1 n/a
9 TRCN0000000821 CCTGGCTGAGATGAATTATGT pLKO.1 2737 CDS 100% 5.625 3.938 N EPHB1 n/a
10 TRCN0000000820 GACTATGAGATCCGGTACTAT pLKO.1 1931 CDS 100% 5.625 3.938 N EPHB1 n/a
11 TRCN0000196959 GCAAGTTCAGTGGCAAGATGT pLKO.1 2079 CDS 100% 4.950 3.465 N EPHB1 n/a
12 TRCN0000000817 CACTCGTTTCCCTTTGCTCAT pLKO.1 3944 3UTR 100% 4.050 2.835 N EPHB1 n/a
13 TRCN0000362367 CCATCGCCTACCGCAAGTTTA pLKO_005 2919 CDS 100% 13.200 9.240 N Ephb1 n/a
14 TRCN0000023501 CCAGGCAAGAGGGAAATCTAT pLKO.1 2456 CDS 100% 5.625 3.938 N Ephb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005866.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14628 pDONR223 0% 94.7% 94.7% None 1297_1458del n/a
2 ccsbBroad304_14628 pLX_304 0% 94.7% 94.7% V5 1297_1458del n/a
3 TRCN0000472498 CTTTCTAGATTTTGCCGGTGTAGC pLX_317 15.7% 94.7% 94.7% V5 1297_1458del n/a
4 TRCN0000489667 GTATAACCCGCCAGGCTTGTTATG pLX_317 8.7% 94.7% 94.7% V5 (not translated due to prior stop codon) 1297_1458del n/a
5 TRCN0000492008 CTTATACTATTATCACAAAACACA pLX_317 29.2% 37.9% 37.9% V5 (not translated due to prior stop codon) 1_1932del n/a
Download CSV