Transcript: Human XM_017006360.1

PREDICTED: Homo sapiens LHFPL tetraspan subfamily member 4 (LHFPL4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LHFPL4 (375323)
Length:
2275
CDS:
863..1279

Additional Resources:

NCBI RefSeq record:
XM_017006360.1
NBCI Gene record:
LHFPL4 (375323)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006360.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437128 ACGGCTACGGTCTACAAGATC pLKO_005 1223 CDS 100% 4.950 6.930 N LHFPL4 n/a
2 TRCN0000166793 CATCTGCTTCGCCATCATCAA pLKO.1 952 CDS 100% 4.950 3.465 N LHFPL4 n/a
3 TRCN0000140585 GCCATCTTCACCATCTGCTTT pLKO.1 941 CDS 100% 4.950 2.475 Y LHFPL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006360.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13636 pDONR223 100% 49.3% 49.3% None (many diffs) n/a
2 ccsbBroad304_13636 pLX_304 0% 49.3% 49.3% V5 (many diffs) n/a
3 TRCN0000465624 GGTTGCTTGTGCATCGGCGCTTCT pLX_317 43.3% 49.3% 49.3% V5 (many diffs) n/a
Download CSV