Transcript: Human XM_017006433.2

PREDICTED: Homo sapiens muscleblind like splicing regulator 1 (MBNL1), transcript variant X28, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MBNL1 (4154)
Length:
4869
CDS:
954..2000

Additional Resources:

NCBI RefSeq record:
XM_017006433.2
NBCI Gene record:
MBNL1 (4154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006433.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063967 CCCATAATATCTGCCGAACAT pLKO.1 1972 CDS 100% 4.950 6.930 N MBNL1 n/a
2 TRCN0000102631 CGCAGTCTTTAACACTGGTAT pLKO.1 1883 CDS 100% 4.950 6.930 N Mbnl1 n/a
3 TRCN0000419160 ATTTGTGCTGAGGTGATATTC pLKO_005 2249 3UTR 100% 13.200 10.560 N MBNL1 n/a
4 TRCN0000429155 GAGATAAATGGACGCAATAAC pLKO_005 1191 CDS 100% 13.200 10.560 N MBNL1 n/a
5 TRCN0000063963 GCAGTCTTTAACACTGGTATT pLKO.1 1884 CDS 100% 10.800 8.640 N MBNL1 n/a
6 TRCN0000063966 CCAATGTTGGTTACAGGGAAT pLKO.1 1413 CDS 100% 4.050 3.240 N MBNL1 n/a
7 TRCN0000226189 CAGTCTTTAACACTGGTATTT pLKO_005 1885 CDS 100% 13.200 9.240 N Mbnl1 n/a
8 TRCN0000427657 GAGTAAAGGACGAGGTCATTA pLKO_005 2080 3UTR 100% 13.200 9.240 N MBNL1 n/a
9 TRCN0000063965 GCCTGCTTTGATTCATTGAAA pLKO.1 1107 CDS 100% 5.625 3.938 N MBNL1 n/a
10 TRCN0000102630 GCACAGAGTTAGCACTCCATA pLKO.1 4608 3UTR 100% 4.950 3.465 N Mbnl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006433.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00980 pDONR223 100% 82.5% 80.2% None 806_859del;1010_1011ins131;1044_1045ins25 n/a
2 ccsbBroad304_00980 pLX_304 0% 82.5% 80.2% V5 806_859del;1010_1011ins131;1044_1045ins25 n/a
3 TRCN0000467871 TGTGAAGGTACTCGGCAACAGACC pLX_317 30.6% 82.5% 80.2% V5 806_859del;1010_1011ins131;1044_1045ins25 n/a
4 ccsbBroadEn_15496 pDONR223 0% 72.5% 70.3% None (many diffs) n/a
5 ccsbBroad304_15496 pLX_304 0% 72.5% 70.3% V5 (many diffs) n/a
Download CSV