Transcript: Human XM_017006649.1

PREDICTED: Homo sapiens GRAM domain containing 1C (GRAMD1C), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRAMD1C (54762)
Length:
3319
CDS:
448..1623

Additional Resources:

NCBI RefSeq record:
XM_017006649.1
NBCI Gene record:
GRAMD1C (54762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006649.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243940 AGATCAGGCCCATCGTTTAAA pLKO_005 1485 CDS 100% 15.000 21.000 N GRAMD1C n/a
2 TRCN0000243937 AGAACGATGACCTACACTATA pLKO_005 772 CDS 100% 13.200 18.480 N GRAMD1C n/a
3 TRCN0000182959 CGTGAACAGATACTGTATCAT pLKO.1 936 CDS 100% 5.625 7.875 N GRAMD1C n/a
4 TRCN0000243938 AGCAAGAATGAGTGGATTATA pLKO_005 3082 3UTR 100% 15.000 10.500 N GRAMD1C n/a
5 TRCN0000243939 CTTTACCAGTTCACGCTTTAT pLKO_005 672 CDS 100% 13.200 9.240 N GRAMD1C n/a
6 TRCN0000179617 GCTGAAGAGCTCACTCATTAT pLKO.1 1542 CDS 100% 13.200 9.240 N GRAMD1C n/a
7 TRCN0000183020 CCATGATTACTTCTATACCGT pLKO.1 918 CDS 100% 0.750 0.525 N GRAMD1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006649.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14169 pDONR223 100% 82% 82% None 1_210del n/a
2 ccsbBroad304_14169 pLX_304 0% 82% 82% V5 1_210del n/a
3 TRCN0000471702 GGCAACGCACCATAGGTCCTAAAC pLX_317 37.3% 82% 82% V5 1_210del n/a
4 ccsbBroadEn_10460 pDONR223 100% 52.2% 52.6% None (many diffs) n/a
5 ccsbBroad304_10460 pLX_304 0% 52.2% 52.6% V5 (not translated due to frame shift) (many diffs) n/a
6 TRCN0000474735 ACCGCAGTCGGGCCAGTCTGCTCG pLX_317 19.9% 52.2% 52.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV