Transcript: Human XM_017006834.2

PREDICTED: Homo sapiens intraflagellar transport 122 (IFT122), transcript variant X22, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IFT122 (55764)
Length:
3635
CDS:
207..3545

Additional Resources:

NCBI RefSeq record:
XM_017006834.2
NBCI Gene record:
IFT122 (55764)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006834.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424279 AGCGCTAGAAGGTTTAGATTT pLKO_005 1829 CDS 100% 13.200 18.480 N IFT122 n/a
2 TRCN0000435858 AGACATGCATTACCGGGTAAA pLKO_005 1133 CDS 100% 10.800 15.120 N IFT122 n/a
3 TRCN0000130990 CGACCTCTGCATGTTTGAGTA pLKO.1 2000 CDS 100% 4.950 6.930 N IFT122 n/a
4 TRCN0000129712 CTACTTTACTAAAGGCGAGTA pLKO.1 734 CDS 100% 4.050 5.670 N IFT122 n/a
5 TRCN0000129312 CCCTTCAAGAGAGGAACGTAA pLKO.1 605 CDS 100% 4.950 3.960 N IFT122 n/a
6 TRCN0000130805 GCTTGTCAAGAAGATTGCCAT pLKO.1 1040 CDS 100% 2.640 1.848 N IFT122 n/a
7 TRCN0000131184 GCAGGTTTAATGATGCTGCCT pLKO.1 2545 CDS 100% 0.660 0.462 N IFT122 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006834.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08583 pDONR223 100% 98.2% 98.3% None 1650A>T;1657_1658ins54;2402_2403insAGC n/a
2 ccsbBroad304_08583 pLX_304 0% 98.2% 98.3% V5 1650A>T;1657_1658ins54;2402_2403insAGC n/a
3 TRCN0000471866 TCCGCGTTGTTACTGGTCATCAGA pLX_317 6.3% 98.2% 98.3% V5 1650A>T;1657_1658ins54;2402_2403insAGC n/a
Download CSV