Transcript: Human XM_017006940.2

PREDICTED: Homo sapiens KIAA1257 (KIAA1257), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA1257 (57501)
Length:
8859
CDS:
551..4090

Additional Resources:

NCBI RefSeq record:
XM_017006940.2
NBCI Gene record:
KIAA1257 (57501)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006940.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268533 AGTCAGATATTACCGATTAAA pLKO_005 1249 CDS 100% 15.000 21.000 N KIAA1257 n/a
2 TRCN0000268545 CGATTCTTCCACGATTCAATG pLKO_005 1525 CDS 100% 10.800 15.120 N KIAA1257 n/a
3 TRCN0000268596 CACTGTGACAAAGGAATTATT pLKO_005 1162 CDS 100% 15.000 12.000 N KIAA1257 n/a
4 TRCN0000268597 GCATTGAGAATACCAACATTG pLKO_005 1359 CDS 100% 10.800 7.560 N KIAA1257 n/a
5 TRCN0000179121 CATGGTGAAACCCTGTTTCTA pLKO.1 7785 3UTR 100% 5.625 2.813 Y LOC339059 n/a
6 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 7398 3UTR 100% 4.950 2.475 Y LOC339059 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7324 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006940.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14231 pDONR223 100% 24.1% 24% None (many diffs) n/a
2 ccsbBroad304_14231 pLX_304 0% 24.1% 24% V5 (many diffs) n/a
3 TRCN0000472915 TAAAGCCAAGCTTTAGGTACCCTT pLX_317 34.6% 24.1% 24% V5 (many diffs) n/a
Download CSV