Transcript: Human XM_017007022.2

PREDICTED: Homo sapiens calsyntenin 2 (CLSTN2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLSTN2 (64084)
Length:
14244
CDS:
308..3100

Additional Resources:

NCBI RefSeq record:
XM_017007022.2
NBCI Gene record:
CLSTN2 (64084)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446439 GACGATTCTGCGCTGACTATC pLKO_005 2861 CDS 100% 10.800 15.120 N CLSTN2 n/a
2 TRCN0000415532 TGATGGAAGGTGACGACATTG pLKO_005 1938 CDS 100% 10.800 15.120 N CLSTN2 n/a
3 TRCN0000054219 CGTGGTCCATATACAGGTGAA pLKO.1 664 CDS 100% 4.050 5.670 N CLSTN2 n/a
4 TRCN0000054218 CGCCTCAAAGTATCCTCCAAA pLKO.1 2030 CDS 100% 4.950 3.465 N CLSTN2 n/a
5 TRCN0000054222 GCGCTACACTAGCAATGAGTT pLKO.1 2560 CDS 100% 4.950 3.465 N CLSTN2 n/a
6 TRCN0000054220 GCTGGATCAGATTTGTGACAA pLKO.1 1567 CDS 100% 4.950 3.465 N CLSTN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12444 pDONR223 100% 96.7% 95.6% None (many diffs) n/a
2 ccsbBroad304_12444 pLX_304 0% 96.7% 95.6% V5 (many diffs) n/a
3 TRCN0000481401 TAGTCACCGCCTACTTCAGGTGGC pLX_317 14.7% 96.7% 95.6% V5 (many diffs) n/a
Download CSV