Transcript: Human XM_017007028.2

PREDICTED: Homo sapiens rabenosyn, RAB effector (RBSN), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBSN (64145)
Length:
6439
CDS:
1089..2726

Additional Resources:

NCBI RefSeq record:
XM_017007028.2
NBCI Gene record:
RBSN (64145)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145414 GCAAAGATTCGAGCAATAGAA pLKO.1 1037 5UTR 100% 5.625 7.875 N RBSN n/a
2 TRCN0000144542 CACTATGTTGTGGAAGTCAAT pLKO.1 969 5UTR 100% 4.950 6.930 N RBSN n/a
3 TRCN0000143722 GAGTACAATCCTTTCGAGGAA pLKO.1 2349 CDS 100% 2.640 2.112 N RBSN n/a
4 TRCN0000143990 CCACAACATCACATCATTCAT pLKO.1 1760 CDS 100% 5.625 3.938 N RBSN n/a
5 TRCN0000143844 CCTTCACTTAGCTCAACTCAA pLKO.1 2136 CDS 100% 4.950 3.465 N RBSN n/a
6 TRCN0000122759 CTTCAGAGAAATCGGCCCTTT pLKO.1 2021 CDS 100% 4.050 2.835 N RBSN n/a
7 TRCN0000142192 GTTGACCAGAAAGCTCCAGAA pLKO.1 1236 CDS 100% 4.050 2.430 N RBSN n/a
8 TRCN0000115862 CACAGTGAAATCCCGTCTCTA pLKO.1 3591 3UTR 100% 4.950 2.475 Y IFIT3 n/a
9 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 4155 3UTR 100% 4.950 2.475 Y CCNJL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03931 pDONR223 100% 69.5% 65.6% None 0_1ins475;123_124ins242 n/a
2 ccsbBroad304_03931 pLX_304 0% 69.5% 65.6% V5 0_1ins475;123_124ins242 n/a
3 TRCN0000472232 TGTCCATGTAGGTTGACAGGGCCA pLX_317 14% 69.5% 65.6% V5 0_1ins475;123_124ins242 n/a
Download CSV