Transcript: Human XM_017007071.2

PREDICTED: Homo sapiens solute carrier family 6 member 1 (SLC6A1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC6A1 (6529)
Length:
5296
CDS:
1223..3022

Additional Resources:

NCBI RefSeq record:
XM_017007071.2
NBCI Gene record:
SLC6A1 (6529)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007071.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429875 CTACATGTTCCTCACCTTAAA pLKO_005 2881 CDS 100% 13.200 18.480 N SLC6A1 n/a
2 TRCN0000042874 CAACCGATTCTATGACAATAT pLKO.1 2653 CDS 100% 13.200 9.240 N SLC6A1 n/a
3 TRCN0000042875 CTTCTACATCACACCCAACTT pLKO.1 2029 CDS 100% 4.950 3.465 N SLC6A1 n/a
4 TRCN0000042873 GCTATCATTCTGGCTGAACAT pLKO.1 1615 CDS 100% 4.950 3.465 N SLC6A1 n/a
5 TRCN0000042877 GTGGAAACTCTGCTGGTCTTT pLKO.1 2707 CDS 100% 4.950 3.465 N SLC6A1 n/a
6 TRCN0000042876 GAGCTACAACTCTTTCCACAA pLKO.1 2143 CDS 100% 4.050 2.835 N SLC6A1 n/a
7 TRCN0000079836 CCTCTTCTACATCACACCCAA pLKO.1 2026 CDS 100% 2.640 1.584 N Slc6a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007071.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06961 pDONR223 100% 99.8% 99.8% None 1047C>G;1562C>A n/a
2 ccsbBroad304_06961 pLX_304 0% 99.8% 99.8% V5 1047C>G;1562C>A n/a
3 TRCN0000473919 GCATGACATGTAAACATCTAAATG pLX_317 23.6% 99.8% 99.8% V5 1047C>G;1562C>A n/a
Download CSV