Transcript: Human XM_017007176.2

PREDICTED: Homo sapiens transmembrane protein 43 (TMEM43), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM43 (79188)
Length:
3507
CDS:
525..1622

Additional Resources:

NCBI RefSeq record:
XM_017007176.2
NBCI Gene record:
TMEM43 (79188)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007176.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142081 CCTCAACCTTATGACACGGAT pLKO.1 1385 CDS 100% 2.640 3.696 N TMEM43 n/a
2 TRCN0000145441 GAGGTGTTTCATAGAGAACTA pLKO.1 1302 CDS 100% 4.950 3.960 N TMEM43 n/a
3 TRCN0000140969 CCTTATGACACGGATCCTCTA pLKO.1 1391 CDS 100% 4.050 3.240 N TMEM43 n/a
4 TRCN0000143247 GAGATGTACCAATGGGTAGAA pLKO.1 777 CDS 100% 4.950 3.465 N TMEM43 n/a
5 TRCN0000142605 GTGAAGAAGGAGACGAGGTAT pLKO.1 834 CDS 100% 4.950 3.465 N TMEM43 n/a
6 TRCN0000141539 CCTTTGTCCAAATTGGCAGGT pLKO.1 967 CDS 100% 2.160 1.512 N TMEM43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007176.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04070 pDONR223 100% 91.2% 91.2% None 0_1ins105 n/a
2 ccsbBroad304_04070 pLX_304 0% 91.2% 91.2% V5 0_1ins105 n/a
3 TRCN0000474125 GACTGACCGACTGGTCCCCTAGCC pLX_317 29% 91.2% 91.2% V5 0_1ins105 n/a
4 ccsbBroadEn_15983 pDONR223 0% 91% 90.5% None (many diffs) n/a
5 ccsbBroad304_15983 pLX_304 0% 91% 90.5% V5 (many diffs) n/a
6 TRCN0000470137 CTTAAATGCTCTCTACTCTTACAG pLX_317 29.9% 91% 90.5% V5 (many diffs) n/a
7 ccsbBroadEn_12558 pDONR223 100% 62.4% 62.4% None 1_411del n/a
8 ccsbBroad304_12558 pLX_304 0% 62.4% 62.4% V5 1_411del n/a
9 TRCN0000474687 ACGTTTCTACGGTGTCCTGTTTAG pLX_317 80.9% 62.4% 62.4% V5 1_411del n/a
Download CSV