Transcript: Human XM_017007310.1

PREDICTED: Homo sapiens chromosome 3 open reading frame 20 (C3orf20), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C3orf20 (84077)
Length:
2548
CDS:
453..2141

Additional Resources:

NCBI RefSeq record:
XM_017007310.1
NBCI Gene record:
C3orf20 (84077)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007310.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417025 CTCTGGAAACGTCGCTGTATG pLKO_005 1619 CDS 100% 10.800 15.120 N C3orf20 n/a
2 TRCN0000160028 CAAGTTTCATTACACCTTCTA pLKO.1 1571 CDS 100% 4.950 6.930 N C3orf20 n/a
3 TRCN0000417199 AGGAGTTGTGTCGCCACATAG pLKO_005 1312 CDS 100% 10.800 7.560 N C3orf20 n/a
4 TRCN0000418240 GATGGCTCCTCCTTCGTTTAC pLKO_005 1593 CDS 100% 10.800 7.560 N C3orf20 n/a
5 TRCN0000160477 CTTCAAGTTTCATTACACCTT pLKO.1 1568 CDS 100% 2.640 1.848 N C3orf20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007310.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04325 pDONR223 100% 47.5% 43.6% None (many diffs) n/a
2 ccsbBroad304_04325 pLX_304 0% 47.5% 43.6% V5 (many diffs) n/a
3 TRCN0000470196 CGTCAGGCTCCCCTGTCCCTCTAC pLX_317 12.2% 47.5% 43.6% V5 (many diffs) n/a
Download CSV