Transcript: Human XM_017007322.2

PREDICTED: Homo sapiens coiled-coil-helix-coiled-coil-helix domain containing 6 (CHCHD6), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHCHD6 (84303)
Length:
8827
CDS:
73..636

Additional Resources:

NCBI RefSeq record:
XM_017007322.2
NBCI Gene record:
CHCHD6 (84303)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007322.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140114 GCCTTCAAGATGGCAACTTGA pLKO.1 233 CDS 100% 0.495 0.396 N CHCHD6 n/a
2 TRCN0000122871 GCATGCTGCTATCCAGGATAA pLKO.1 351 CDS 100% 10.800 7.560 N CHCHD6 n/a
3 TRCN0000139611 CTTTGGCCTTCAAGATGGCAA pLKO.1 228 CDS 100% 2.640 1.848 N CHCHD6 n/a
4 TRCN0000139744 CAAGAGGTATGAACAGGAGCA pLKO.1 333 CDS 100% 2.160 1.512 N CHCHD6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007322.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04366 pDONR223 100% 73.1% 71.6% None (many diffs) n/a
2 ccsbBroad304_04366 pLX_304 0% 73.1% 71.6% V5 (many diffs) n/a
3 TRCN0000467250 ACATCTTCCGGCGTCTCCTCGCAG pLX_317 65.6% 73.1% 71.6% V5 (many diffs) n/a
Download CSV