Transcript: Human XM_017007650.2

PREDICTED: Homo sapiens CDP-diacylglycerol synthase 1 (CDS1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDS1 (1040)
Length:
4281
CDS:
472..1554

Additional Resources:

NCBI RefSeq record:
XM_017007650.2
NBCI Gene record:
CDS1 (1040)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007650.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035843 CCTGAACAGCAGTTAAATATA pLKO.1 1550 CDS 100% 15.000 21.000 N CDS1 n/a
2 TRCN0000426312 GATTCTGATATTCCGGAAATT pLKO_005 634 CDS 100% 13.200 18.480 N CDS1 n/a
3 TRCN0000426346 GAACACTAAGTTGGTACTTTC pLKO_005 899 CDS 100% 10.800 15.120 N CDS1 n/a
4 TRCN0000422151 CAACCCACCTTGAAGGTATAA pLKO_005 1613 3UTR 100% 13.200 9.240 N CDS1 n/a
5 TRCN0000035840 GCTGCCTATGTGTTATCCAAA pLKO.1 1351 CDS 100% 4.950 3.465 N CDS1 n/a
6 TRCN0000035841 GCTTCCATGAAATTATCACTA pLKO.1 836 CDS 100% 4.950 3.465 N CDS1 n/a
7 TRCN0000035842 CCAGCGACAAAGAAACAGATA pLKO.1 578 CDS 100% 4.950 2.970 N CDS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007650.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00286 pDONR223 100% 78% 75.4% None 1030_1031ins224;1080_1081ins79 n/a
2 ccsbBroad304_00286 pLX_304 0% 78% 75.4% V5 1030_1031ins224;1080_1081ins79 n/a
3 TRCN0000476870 CCTTATTCGGCCTCCTTTGTAGAA pLX_317 7.2% 78% 75.4% V5 1030_1031ins224;1080_1081ins79 n/a
Download CSV