Transcript: Human XM_017007949.1

PREDICTED: Homo sapiens tripartite motif containing 2 (TRIM2), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM2 (23321)
Length:
7266
CDS:
681..2915

Additional Resources:

NCBI RefSeq record:
XM_017007949.1
NBCI Gene record:
TRIM2 (23321)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310670 ACAACCTCGGGACGATCTTAA pLKO_005 1618 CDS 100% 13.200 18.480 N TRIM2 n/a
2 TRCN0000073033 GCACCTTAGAACTGTACTATA pLKO.1 4561 3UTR 100% 13.200 18.480 N TRIM2 n/a
3 TRCN0000073035 GCATCGTGGATGACATTCATT pLKO.1 1276 CDS 100% 5.625 7.875 N TRIM2 n/a
4 TRCN0000303296 TCCATGGTCTTGCACTATAAA pLKO_005 2939 3UTR 100% 15.000 12.000 N TRIM2 n/a
5 TRCN0000037305 CGCCAGATTGACAAGCAGTTT pLKO.1 720 CDS 100% 4.950 3.960 N Trim2 n/a
6 TRCN0000308329 CGCCAGATTGACAAGCAGTTT pLKO_005 720 CDS 100% 4.950 3.960 N Trim2 n/a
7 TRCN0000303297 TTTGATGGGAGTGGATCATTT pLKO_005 2766 CDS 100% 13.200 9.240 N TRIM2 n/a
8 TRCN0000073036 CGCGCTCCAGAACAATTTCTT pLKO.1 905 CDS 100% 5.625 3.938 N TRIM2 n/a
9 TRCN0000291873 CGCGCTCCAGAACAATTTCTT pLKO_005 905 CDS 100% 5.625 3.938 N TRIM2 n/a
10 TRCN0000073034 GCACATTATTGTTGTGGACAA pLKO.1 2441 CDS 100% 4.050 2.835 N TRIM2 n/a
11 TRCN0000073037 GTCAAGCAGAAAGCTGTGAAA pLKO.1 2016 CDS 100% 4.950 2.970 N TRIM2 n/a
12 TRCN0000291872 GTCAAGCAGAAAGCTGTGAAA pLKO_005 2016 CDS 100% 4.950 2.970 N TRIM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02752 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02752 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471497 ACCACCTGACCTTTTGCAACCCGA pLX_317 16% 100% 100% V5 n/a
Download CSV