Transcript: Human XM_017008041.1

PREDICTED: Homo sapiens ring finger protein 212 (RNF212), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF212 (285498)
Length:
743
CDS:
117..611

Additional Resources:

NCBI RefSeq record:
XM_017008041.1
NBCI Gene record:
RNF212 (285498)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008041.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073247 TCAAAGCATACCGACGCAGAT pLKO.1 279 CDS 100% 4.050 5.670 N RNF212 n/a
2 TRCN0000073245 GCTTGATTTGTAAAGCTCCTT pLKO.1 241 CDS 100% 2.640 2.112 N RNF212 n/a
3 TRCN0000073246 CCAGGCATTCTTCATGAGCAT pLKO.1 302 CDS 100% 2.640 1.848 N RNF212 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008041.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13551 pDONR223 100% 49.1% 36.7% None (many diffs) n/a
2 ccsbBroad304_13551 pLX_304 0% 49.1% 36.7% V5 (many diffs) n/a
3 TRCN0000480141 CGGACAGCCAGTTTCAGTTCGCGG pLX_317 43.9% 49.1% 36.7% V5 (many diffs) n/a
4 ccsbBroadEn_05398 pDONR223 100% 45.8% 31.8% None (many diffs) n/a
5 ccsbBroad304_05398 pLX_304 0% 45.8% 31.8% V5 (many diffs) n/a
Download CSV