Transcript: Human XM_017008166.2

PREDICTED: Homo sapiens complement factor I (CFI), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFI (3426)
Length:
1745
CDS:
70..1677

Additional Resources:

NCBI RefSeq record:
XM_017008166.2
NBCI Gene record:
CFI (3426)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364955 CGACCTTAAACGTATAGTAAT pLKO_005 1275 CDS 100% 13.200 18.480 N CFI n/a
2 TRCN0000050228 CCGACCTTAAACGTATAGTAA pLKO.1 1274 CDS 100% 5.625 7.875 N CFI n/a
3 TRCN0000050231 CCGAAGGAAAGTTTAGTGTTT pLKO.1 392 CDS 100% 4.950 6.930 N CFI n/a
4 TRCN0000364954 ACTCACCTCTCCTGCGATAAA pLKO_005 184 CDS 100% 13.200 9.240 N CFI n/a
5 TRCN0000369978 CCATGGCAGGTGGCAATTAAG pLKO_005 1123 CDS 100% 13.200 9.240 N CFI n/a
6 TRCN0000369977 TGCAGAAAGAAGACGGATAAA pLKO_005 1005 CDS 100% 13.200 9.240 N CFI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10900 pDONR223 100% 67.5% 65.7% None (many diffs) n/a
2 ccsbBroad304_10900 pLX_304 0% 67.5% 65.7% V5 (many diffs) n/a
3 TRCN0000473929 TTGGGTCCACCCGTTTGTTTTTAA pLX_317 46% 67.5% 65.7% V5 (many diffs) n/a
Download CSV