Transcript: Human XM_017008333.1

PREDICTED: Homo sapiens HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 (HERC6), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HERC6 (55008)
Length:
3447
CDS:
966..2810

Additional Resources:

NCBI RefSeq record:
XM_017008333.1
NBCI Gene record:
HERC6 (55008)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008333.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160044 CGTCAATTAAGTCAAGCTGAA pLKO.1 1800 CDS 100% 4.050 5.670 N HERC6 n/a
2 TRCN0000158995 GCATAAGGTATCAAACCACAT pLKO.1 3098 3UTR 100% 4.050 5.670 N HERC6 n/a
3 TRCN0000160600 CCAACATCAATAACTTGTCAT pLKO.1 2679 CDS 100% 4.950 3.960 N HERC6 n/a
4 TRCN0000160017 CCAGGACATTCATTTGCATAA pLKO.1 3174 3UTR 100% 10.800 7.560 N HERC6 n/a
5 TRCN0000160299 CCACTGTATGTTTGAAGAGAT pLKO.1 1904 CDS 100% 4.950 3.465 N HERC6 n/a
6 TRCN0000163307 GCTGAAGACTTCGTGGATGTT pLKO.1 881 5UTR 100% 4.950 3.465 N HERC6 n/a
7 TRCN0000162737 CCTAAAGAAGTGTTGGGCATT pLKO.1 1295 CDS 100% 4.050 2.835 N HERC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008333.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12132 pDONR223 100% 61.7% 61.7% None 1_705del n/a
2 ccsbBroad304_12132 pLX_304 0% 61.7% 61.7% V5 1_705del n/a
3 TRCN0000474135 GAACATGCGACACGCTATGTCGGC pLX_317 46.4% 61.7% 61.7% V5 1_705del n/a
Download CSV