Transcript: Human XM_017008365.1

PREDICTED: Homo sapiens protein phosphatase 3 catalytic subunit alpha (PPP3CA), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP3CA (5530)
Length:
3979
CDS:
16..1545

Additional Resources:

NCBI RefSeq record:
XM_017008365.1
NBCI Gene record:
PPP3CA (5530)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382008 AGTATTCAGAACGCGTATATG pLKO_005 485 CDS 100% 13.200 18.480 N PPP3CA n/a
2 TRCN0000342618 ATAACAGAGGGTGCATCAATT pLKO_005 172 CDS 100% 13.200 18.480 N PPP3CA n/a
3 TRCN0000081060 CGCCAACCTTAACTCCATCAA pLKO.1 1458 CDS 100% 4.950 6.930 N Ppp3ca n/a
4 TRCN0000309719 CGCCAACCTTAACTCCATCAA pLKO_005 1458 CDS 100% 4.950 6.930 N Ppp3ca n/a
5 TRCN0000342567 CAAGGGCTTAGACCGAATTAA pLKO_005 1398 CDS 100% 15.000 12.000 N PPP3CA n/a
6 TRCN0000002754 CGAAGATTTAAGATACACCAA pLKO.1 3537 3UTR 100% 2.640 2.112 N PPP3CA n/a
7 TRCN0000002752 GAATAATAACAGAGGGTGCAT pLKO.1 167 CDS 100% 2.640 2.112 N PPP3CA n/a
8 TRCN0000342619 GAAAGCTAATGCTAGTATATA pLKO_005 1812 3UTR 100% 15.000 10.500 N PPP3CA n/a
9 TRCN0000352706 TATCTTAAAGGCGCATCTTAT pLKO_005 111 CDS 100% 13.200 9.240 N PPP3CA n/a
10 TRCN0000382297 AGGAACAAGATCCGAGCAATA pLKO_005 1168 CDS 100% 10.800 7.560 N PPP3CA n/a
11 TRCN0000002750 CACCACAACATAAGATCACTA pLKO.1 1364 CDS 100% 4.950 3.465 N PPP3CA n/a
12 TRCN0000002751 GCTGTATTTGTGGGCCTTGAA pLKO.1 369 CDS 100% 4.950 3.465 N PPP3CA n/a
13 TRCN0000352645 GCTGTATTTGTGGGCCTTGAA pLKO_005 369 CDS 100% 4.950 3.465 N PPP3CA n/a
14 TRCN0000002753 GATGCCTGTATGGATGCCTTT pLKO.1 505 CDS 100% 4.050 2.835 N PPP3CA n/a
15 TRCN0000081058 GCCAGGAATTGGATTCAGTTT pLKO.1 1671 3UTR 100% 4.950 2.970 N Ppp3ca n/a
16 TRCN0000309716 GCCAGGAATTGGATTCAGTTT pLKO_005 1671 3UTR 100% 4.950 2.970 N Ppp3ca n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01266 pDONR223 100% 95.3% 94.4% None (many diffs) n/a
2 ccsbBroad304_01266 pLX_304 0% 95.3% 94.4% V5 (many diffs) n/a
3 TRCN0000472901 TCACCCGCGCCAACGTTTCGGTAA pLX_317 31.4% 95.3% 94.4% V5 (many diffs) n/a
Download CSV