Transcript: Human XM_017008559.1

PREDICTED: Homo sapiens bone morphogenetic protein receptor type 1B (BMPR1B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BMPR1B (658)
Length:
5624
CDS:
336..1844

Additional Resources:

NCBI RefSeq record:
XM_017008559.1
NBCI Gene record:
BMPR1B (658)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148600 TGATGGACCTATACACCACA pXPR_003 GGG 373 25% 8 0.8065 BMPR1B BMPR1B 77491
2 BRDN0001148923 GATTGGAAAAGGTCGCTATG pXPR_003 GGG 643 43% 10 0.6562 BMPR1B BMPR1B 77490
3 BRDN0001149274 TCTAACCCAATGCTGTATCG pXPR_003 AGG 474 31% 9 0.1581 BMPR1B BMPR1B 77489
4 BRDN0001145690 CATTGATTTAGCGTCTAGGG pXPR_003 TGG 886 59% 11 -0.1540 BMPR1B BMPR1B 77488
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008559.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000455 TCAGGAGGTATAGTGGAAGAA pLKO.1 1581 CDS 100% 4.950 6.930 N BMPR1B n/a
2 TRCN0000000454 GACGAGAGCTTGAACAGAAAT pLKO.1 1485 CDS 100% 13.200 10.560 N BMPR1B n/a
3 TRCN0000342581 GACGAGAGCTTGAACAGAAAT pLKO_005 1485 CDS 100% 13.200 10.560 N BMPR1B n/a
4 TRCN0000000452 CGGATATTGTTTCACGATGAT pLKO.1 485 CDS 100% 4.950 3.960 N BMPR1B n/a
5 TRCN0000000451 GACATCAAATAAGCATCCACA pLKO.1 1914 3UTR 100% 2.640 2.112 N BMPR1B n/a
6 TRCN0000195660 CCAAAGGTCTTGCGTTGTAAA pLKO.1 414 CDS 100% 13.200 9.240 N BMPR1B n/a
7 TRCN0000361009 CCTCATCAAAGAAGATCAATT pLKO_005 594 CDS 100% 13.200 9.240 N Bmpr1b n/a
8 TRCN0000194864 CTCATCAAAGAAGATCAATTG pLKO.1 595 CDS 100% 10.800 7.560 N BMPR1B n/a
9 TRCN0000199481 GAGCAGTGATGAGTGTCTAAG pLKO.1 1706 CDS 100% 10.800 7.560 N BMPR1B n/a
10 TRCN0000342630 GAGCAGTGATGAGTGTCTAAG pLKO_005 1706 CDS 100% 10.800 7.560 N BMPR1B n/a
11 TRCN0000197141 GATGTGTATCAGGAGGTATAG pLKO.1 1573 CDS 100% 10.800 7.560 N BMPR1B n/a
12 TRCN0000342582 GATGTGTATCAGGAGGTATAG pLKO_005 1573 CDS 100% 10.800 7.560 N BMPR1B n/a
13 TRCN0000000453 CCTCGATACAGCATTGGGTTA pLKO.1 804 CDS 100% 4.050 2.835 N BMPR1B n/a
14 TRCN0000199418 CTCTGCAGAAAGCCAACAGGT pLKO.1 1866 3UTR 100% 2.640 1.848 N BMPR1B n/a
15 TRCN0000199659 GCCTTGAACATCGTCCTGCTT pLKO.1 1941 3UTR 100% 2.640 1.848 N BMPR1B n/a
16 TRCN0000352653 GCCTTGAACATCGTCCTGCTT pLKO_005 1941 3UTR 100% 2.640 1.848 N BMPR1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008559.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00168 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00168 pLX_304 44.8% 100% 100% V5 n/a
3 TRCN0000469201 GGACTTGCCCGCCAAGATATAGTT pLX_317 34% 100% 100% V5 n/a
4 ccsbBroadEn_14550 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14550 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000481329 CTATGCAATTCTCGGTCGTTAGTC pLX_317 27.1% 100% 100% V5 n/a
7 TRCN0000488008 CAGCAATTTACAGCCACCATTAAC pLX_317 19.8% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV