Transcript: Human XM_017008855.1

PREDICTED: Homo sapiens clock circadian regulator (CLOCK), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLOCK (9575)
Length:
7548
CDS:
190..2553

Additional Resources:

NCBI RefSeq record:
XM_017008855.1
NBCI Gene record:
CLOCK (9575)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008855.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018976 CGCACACATAGGCCATCTTAT pLKO.1 727 CDS 100% 13.200 18.480 N CLOCK n/a
2 TRCN0000319006 CGCACACATAGGCCATCTTAT pLKO_005 727 CDS 100% 13.200 18.480 N CLOCK n/a
3 TRCN0000018978 CGACGAGAACTTGGCATTGAA pLKO.1 1168 CDS 100% 5.625 4.500 N CLOCK n/a
4 TRCN0000319007 CGACGAGAACTTGGCATTGAA pLKO_005 1168 CDS 100% 5.625 4.500 N CLOCK n/a
5 TRCN0000311544 GGGAACATCAGGCTATGATTA pLKO_005 927 CDS 100% 13.200 9.240 N Clock n/a
6 TRCN0000018975 CGTTCAACTTTCTTCTGGAAA pLKO.1 1746 CDS 100% 4.950 3.465 N CLOCK n/a
7 TRCN0000319009 CGTTCAACTTTCTTCTGGAAA pLKO_005 1746 CDS 100% 4.950 3.465 N CLOCK n/a
8 TRCN0000018974 GCCAAGATTCTGGGTCAGATA pLKO.1 1220 CDS 100% 4.950 3.465 N CLOCK n/a
9 TRCN0000319008 GCCAAGATTCTGGGTCAGATA pLKO_005 1220 CDS 100% 4.950 3.465 N CLOCK n/a
10 TRCN0000018977 GCGAGGAACAATAGACCCAAA pLKO.1 606 CDS 100% 4.050 2.835 N CLOCK n/a
11 TRCN0000319005 GCGAGGAACAATAGACCCAAA pLKO_005 606 CDS 100% 4.050 2.835 N CLOCK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008855.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02201 pDONR223 100% 92.9% 93% None 0_1ins177;1587T>C n/a
2 ccsbBroad304_02201 pLX_304 26.6% 92.9% 93% V5 0_1ins177;1587T>C n/a
3 TRCN0000477413 GTCAACCAAAAGGACTTGCGATCT pLX_317 20.4% 92.9% 93% V5 0_1ins177;1587T>C n/a
Download CSV