Transcript: Human XM_017008870.2

PREDICTED: Homo sapiens microfibril associated protein 3 like (MFAP3L), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MFAP3L (9848)
Length:
7981
CDS:
1976..3205

Additional Resources:

NCBI RefSeq record:
XM_017008870.2
NBCI Gene record:
MFAP3L (9848)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008870.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421526 ATCGTCATGGTCCTCAATATC pLKO_005 2462 CDS 100% 13.200 18.480 N MFAP3L n/a
2 TRCN0000444561 CCTTCTCAGACCGAGGTAAAT pLKO_005 2322 CDS 100% 13.200 10.560 N MFAP3L n/a
3 TRCN0000116946 GTGTGTGGCTTCTAACATCTA pLKO.1 2347 CDS 100% 4.950 3.960 N MFAP3L n/a
4 TRCN0000116943 CCACAGTTCAAGTGGTATAAT pLKO.1 2201 CDS 100% 15.000 10.500 N MFAP3L n/a
5 TRCN0000116944 GCCAGAACTGACCATATCATA pLKO.1 2126 CDS 100% 5.625 3.938 N MFAP3L n/a
6 TRCN0000116942 GCCTTGATTAACTGTAGTGTT pLKO.1 2165 CDS 100% 4.950 3.465 N MFAP3L n/a
7 TRCN0000116945 CAGGACTATCATGGAGGAGAT pLKO.1 2725 CDS 100% 4.050 2.835 N MFAP3L n/a
8 TRCN0000424362 TTACGAAAGCCATGTCTAATA pLKO_005 3187 CDS 100% 13.200 7.920 N MFAP3L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008870.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11423 pDONR223 100% 24.7% 24.4% None (many diffs) n/a
2 ccsbBroad304_11423 pLX_304 0% 24.7% 24.4% V5 (many diffs) n/a
3 TRCN0000469608 AGTGCGCAACGAGGCCGGCCCCCA pLX_317 100% 24.7% 24.4% V5 (many diffs) n/a
Download CSV