Transcript: Human XM_017008986.1

PREDICTED: Homo sapiens SUB1 regulator of transcription (SUB1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SUB1 (10923)
Length:
3603
CDS:
225..608

Additional Resources:

NCBI RefSeq record:
XM_017008986.1
NBCI Gene record:
SUB1 (10923)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008986.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014970 GTACGTTAGTGTTCGCGATTT pLKO.1 434 CDS 100% 10.800 15.120 N SUB1 n/a
2 TRCN0000349582 GTACGTTAGTGTTCGCGATTT pLKO_005 434 CDS 100% 10.800 15.120 N SUB1 n/a
3 TRCN0000014969 ACATTGATGATGCAGTAAGAA pLKO.1 580 CDS 100% 5.625 3.938 N SUB1 n/a
4 TRCN0000318784 ACATTGATGATGCAGTAAGAA pLKO_005 580 CDS 100% 5.625 3.938 N SUB1 n/a
5 TRCN0000014968 GAACAGATTTCTGACATTGAT pLKO.1 567 CDS 100% 5.625 3.938 N SUB1 n/a
6 TRCN0000318783 GAACAGATTTCTGACATTGAT pLKO_005 567 CDS 100% 5.625 3.938 N SUB1 n/a
7 TRCN0000014971 AGCCAGCTGAAGGAACAGATT pLKO.1 555 CDS 100% 4.950 3.465 N SUB1 n/a
8 TRCN0000318782 AGCCAGCTGAAGGAACAGATT pLKO_005 555 CDS 100% 4.950 3.465 N SUB1 n/a
9 TRCN0000014972 GAAGGAACAGATTTCTGACAT pLKO.1 563 CDS 100% 4.950 3.465 N SUB1 n/a
10 TRCN0000304667 TAGAGAATATTGGATGGATTC pLKO_005 479 CDS 100% 6.000 4.200 N Sub1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008986.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07704 pDONR223 100% 99.7% 99.2% None 377A>C n/a
2 ccsbBroad304_07704 pLX_304 0% 99.7% 99.2% V5 377A>C n/a
3 TRCN0000465394 GGTAACAGCCCATGAAGGTGTATG pLX_317 60.3% 99.7% 99.2% V5 377A>C n/a
4 ccsbBroadEn_15731 pDONR223 0% 99.7% 99.2% None 31A>G n/a
5 ccsbBroad304_15731 pLX_304 0% 99.7% 99.2% V5 31A>G n/a
6 TRCN0000468945 AATAAACTGGAATCAAGCGCCTCC pLX_317 96.5% 99.4% 5% V5 (not translated due to prior stop codon) 12delA;31A>G n/a
Download CSV