Transcript: Human XM_017009061.2

PREDICTED: Homo sapiens casein kinase 1 gamma 3 (CSNK1G3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CSNK1G3 (1456)
Length:
4480
CDS:
663..2105

Additional Resources:

NCBI RefSeq record:
XM_017009061.2
NBCI Gene record:
CSNK1G3 (1456)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009061.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355670 TTTCGGCCCTTGTGGTAAATA pLKO_005 1049 CDS 100% 15.000 21.000 N CSNK1G3 n/a
2 TRCN0000338169 TAATGGTTGGACCTAACTTTA pLKO_005 772 CDS 100% 13.200 18.480 N CSNK1G3 n/a
3 TRCN0000196591 GCAACATATCTTCGTTATGTA pLKO.1 1587 CDS 100% 0.563 0.788 N CSNK1G3 n/a
4 TRCN0000338228 CAAAGTAGAAGAGACGATTTA pLKO_005 1413 CDS 100% 13.200 10.560 N CSNK1G3 n/a
5 TRCN0000010550 CCCAGCAAGTTATTCACATTA pLKO.1 1267 CDS 100% 13.200 10.560 N CSNK1G3 n/a
6 TRCN0000196897 GCTAGATATATGAGCATAAAC pLKO.1 1374 CDS 100% 13.200 9.240 N CSNK1G3 n/a
7 TRCN0000196403 GTGATGTATGTTGGAGTTATA pLKO.1 2921 3UTR 100% 13.200 9.240 N CSNK1G3 n/a
8 TRCN0000355669 TTTCCAGAAATGGCAACATAT pLKO_005 1575 CDS 100% 13.200 9.240 N CSNK1G3 n/a
9 TRCN0000420971 TAGGATCTGGAGATGGTATAC pLKO_005 1015 CDS 100% 10.800 7.560 N Csnk1g3 n/a
10 TRCN0000000808 CACCGAAACTTACTGCTGAAT pLKO.1 3015 3UTR 100% 4.950 3.465 N CSNK1G3 n/a
11 TRCN0000338227 CACCGAAACTTACTGCTGAAT pLKO_005 3015 3UTR 100% 4.950 3.465 N CSNK1G3 n/a
12 TRCN0000195537 CCCTACTGAAGTAGAAGTGAT pLKO.1 1994 CDS 100% 4.950 3.465 N CSNK1G3 n/a
13 TRCN0000000809 CCGGAGACAAAGAAACACATA pLKO.1 1320 CDS 100% 4.950 3.465 N CSNK1G3 n/a
14 TRCN0000338167 CCGGAGACAAAGAAACACATA pLKO_005 1320 CDS 100% 4.950 3.465 N CSNK1G3 n/a
15 TRCN0000000810 AGGACGTTCAAATGCACCCAT pLKO.1 1967 CDS 100% 2.640 1.848 N CSNK1G3 n/a
16 TRCN0000000811 ACTTCTTAATAGGACGACCAA pLKO.1 1237 CDS 100% 2.640 3.696 N CSNK1G3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009061.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06057 pDONR223 100% 88% 87.9% None 177_251del;346A>G;1159_1254del n/a
2 ccsbBroad304_06057 pLX_304 0% 88% 87.9% V5 177_251del;346A>G;1159_1254del n/a
3 TRCN0000477806 CGATTTGCAATTGATGCTTGGCAT pLX_317 26.7% 88% 87.9% V5 177_251del;346A>G;1159_1254del n/a
4 ccsbBroadEn_14603 pDONR223 100% 87.9% 87.5% None (many diffs) n/a
5 ccsbBroad304_14603 pLX_304 0% 87.9% 87.5% V5 (many diffs) n/a
6 TRCN0000467288 CGAATTGCCCCTTACTCTATAGGA pLX_317 11.6% 87.9% 87.5% V5 (many diffs) n/a
7 TRCN0000489721 TTAGACGGACATTGTATCAGTATC pLX_317 94.5% 23.4% 20.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV