Transcript: Human XM_017009131.1

PREDICTED: Homo sapiens PRELI domain containing 2 (PRELID2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRELID2 (153768)
Length:
930
CDS:
119..688

Additional Resources:

NCBI RefSeq record:
XM_017009131.1
NBCI Gene record:
PRELID2 (153768)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254565 AGAGTCTGTCTTCCGGGAAAG pLKO_005 484 CDS 100% 6.000 4.800 N Prelid2 n/a
2 TRCN0000241577 AGAACGTGGTTCCAGAAATTT pLKO_005 297 CDS 100% 15.000 10.500 N PRELID2 n/a
3 TRCN0000241578 AGGGAGCCCAGAAGGGAATTA pLKO_005 615 CDS 100% 13.200 9.240 N PRELID2 n/a
4 TRCN0000241574 CAAATTGGACAGAGTTCATTC pLKO_005 516 CDS 100% 10.800 7.560 N PRELID2 n/a
5 TRCN0000241576 GAAAGTACCTAATATCCAATT pLKO_005 373 CDS 100% 10.800 7.560 N PRELID2 n/a
6 TRCN0000172994 GCTCAATCCTCGGGAAAGAAA pLKO.1 409 CDS 100% 5.625 3.938 N PRELID2 n/a
7 TRCN0000172736 GAAGAGGAGTCATGGCTCAAT pLKO.1 395 CDS 100% 4.950 3.465 N PRELID2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05076 pDONR223 100% 78.3% 78.3% None 1_87del;205_240del n/a
2 ccsbBroad304_05076 pLX_304 0% 78.3% 78.3% V5 1_87del;205_240del n/a
3 TRCN0000478938 ATCTGGGATGTCCCTGGAATAAGA pLX_317 84.9% 78.3% 78.3% V5 1_87del;205_240del n/a
Download CSV