Transcript: Human XM_017009236.1

PREDICTED: Homo sapiens Rho related BTB domain containing 3 (RHOBTB3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHOBTB3 (22836)
Length:
4083
CDS:
881..2134

Additional Resources:

NCBI RefSeq record:
XM_017009236.1
NBCI Gene record:
RHOBTB3 (22836)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009236.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048647 GCCGATGTTGTCTTCGAAATT pLKO.1 1556 CDS 100% 13.200 18.480 N RHOBTB3 n/a
2 TRCN0000291537 GCCGATGTTGTCTTCGAAATT pLKO_005 1556 CDS 100% 13.200 18.480 N RHOBTB3 n/a
3 TRCN0000331173 GATCGTTCTCTGCGCTGTAAG pLKO_005 1111 CDS 100% 10.800 15.120 N RHOBTB3 n/a
4 TRCN0000048643 GCCGTCGAATATGTACTTGAA pLKO.1 2053 CDS 100% 4.950 6.930 N RHOBTB3 n/a
5 TRCN0000048645 GCTTCATTTATTCAGGTGCTT pLKO.1 1332 CDS 100% 2.640 3.696 N RHOBTB3 n/a
6 TRCN0000296940 CTGTTGCTTTAGTGATATTTA pLKO_005 2394 3UTR 100% 15.000 10.500 N RHOBTB3 n/a
7 TRCN0000048644 GCATCCATGAACCTTGATATA pLKO.1 1877 CDS 100% 13.200 9.240 N RHOBTB3 n/a
8 TRCN0000291590 GCATCCATGAACCTTGATATA pLKO_005 1877 CDS 100% 13.200 9.240 N RHOBTB3 n/a
9 TRCN0000296939 GTGATCAAATACAACGTTAAT pLKO_005 587 5UTR 100% 13.200 9.240 N RHOBTB3 n/a
10 TRCN0000048646 CATTCCATGAAGTAAAGGATA pLKO.1 618 5UTR 100% 4.950 3.465 N RHOBTB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009236.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07806 pDONR223 100% 68.1% 68% None 0_1ins582;195C>T;202A>G n/a
2 ccsbBroad304_07806 pLX_304 0% 68.1% 68% V5 0_1ins582;195C>T;202A>G n/a
Download CSV